ID: 1138582862

View in Genome Browser
Species Human (GRCh38)
Location 16:57952952-57952974
Sequence CCCCAGGGCAGGCCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 536}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138582844_1138582862 28 Left 1138582844 16:57952901-57952923 CCCAAGATCACCAACCTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 311
Right 1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG 0: 1
1: 0
2: 7
3: 65
4: 536
1138582846_1138582862 27 Left 1138582846 16:57952902-57952924 CCAAGATCACCAACCTGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG 0: 1
1: 0
2: 7
3: 65
4: 536
1138582851_1138582862 18 Left 1138582851 16:57952911-57952933 CCAACCTGGAAGGGGAGGGATTG 0: 1
1: 0
2: 0
3: 19
4: 205
Right 1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG 0: 1
1: 0
2: 7
3: 65
4: 536
1138582854_1138582862 14 Left 1138582854 16:57952915-57952937 CCTGGAAGGGGAGGGATTGGGTA 0: 1
1: 0
2: 1
3: 26
4: 291
Right 1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG 0: 1
1: 0
2: 7
3: 65
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138582862 Original CRISPR CCCCAGGGCAGGCCCCCAGG AGG Intronic
900330911 1:2133982-2134004 GCCCAGGCCTGGCGCCCAGGTGG + Intronic
900475738 1:2875607-2875629 CCCCAGGCCAGGCCACCAGGCGG - Intergenic
900511233 1:3062099-3062121 CCCCAGGGCAGGCCCCACCTAGG + Intergenic
900659551 1:3775745-3775767 CCCCAGGCCAGGGCCGCATGAGG - Intronic
900724982 1:4210241-4210263 TCACAGGGCAGGCCCCCAGGTGG - Intergenic
900956918 1:5891960-5891982 GCCCAGGGTGGGCCCCAAGGGGG + Intronic
901314265 1:8295195-8295217 AGCCAGGGCAGACCCCAAGGAGG + Intergenic
901423352 1:9165394-9165416 CTCCACGGCAGGCCCTGAGGTGG + Intergenic
901532835 1:9864218-9864240 GACCAGGGCATGGCCCCAGGAGG + Intronic
901626650 1:10628765-10628787 CCGCAGGGCTGTCCCCCAGCAGG - Intronic
901703452 1:11057667-11057689 GGTCAGGGCAGGCCTCCAGGAGG - Intronic
901858198 1:12057577-12057599 ATGCAGGGCAGGCCCACAGGAGG - Intergenic
902617994 1:17634456-17634478 CCCCATGGCTGGCCCCCAGCGGG + Intronic
902837956 1:19058769-19058791 CTCCAGGGCAGACCCCAAGGGGG + Intergenic
902932373 1:19740667-19740689 CCCCAGGGCAGGCACCGTGCTGG - Intronic
903182394 1:21611570-21611592 CCCCGGGGCAGGTTCCGAGGAGG - Exonic
903522206 1:23959490-23959512 CCCCAGGGCAGTCCCAAGGGCGG + Intronic
903767357 1:25743400-25743422 CCCTGGGGCAGCTCCCCAGGAGG - Intronic
903846321 1:26281549-26281571 GCCCAGGGCAGGGACCCAGGAGG - Intronic
904041134 1:27585924-27585946 CCCTAGGACAGACCTCCAGGGGG - Intronic
904266907 1:29323514-29323536 CCCCAGGGAAGGACCCTGGGTGG + Intronic
904382196 1:30119145-30119167 CCCCACTGCAGCCCCCCAGGCGG - Intergenic
904622652 1:31784527-31784549 CCCCAGGCCAGGATGCCAGGAGG + Intergenic
905265630 1:36752781-36752803 CCCCAGCTCAGCCCCCCAGCAGG + Intergenic
905586598 1:39124172-39124194 CACCATGCCAGGCCCCCAGGTGG + Intronic
906049497 1:42858620-42858642 CACCAGGGCAGTTCCCCAGGAGG + Intergenic
912435756 1:109659970-109659992 CCCCAGGCCTGGTACCCAGGTGG - Intronic
912443496 1:109716103-109716125 CCCCAGGCCCGGTACCCAGGTGG - Intronic
912552382 1:110492547-110492569 CCCCAGGAGATGCCCCCAGATGG - Intergenic
913334427 1:117696045-117696067 ACCCAGGGCAGCCCCGCTGGAGG - Intergenic
913550875 1:119915850-119915872 CCCCAGAGCAGGCCACCTGAAGG - Exonic
913578071 1:120197209-120197231 CCCCACGGCAGACCCCGAGCCGG + Intergenic
913630101 1:120701143-120701165 CCCCACGGCAGACCCCGAGCCGG - Intergenic
914559987 1:148808629-148808651 CCCCACGGCAGACCCCGAGCCGG + Intronic
914612846 1:149321586-149321608 CCCCACGGCAGACCCCGAGCCGG - Intergenic
915317048 1:155034523-155034545 CCCCAGCGCCTGCCCCCAGCAGG - Exonic
915555599 1:156659116-156659138 CCCCATGCCAGGTCCCTAGGGGG + Exonic
915743915 1:158141634-158141656 CCGCAGGACAGTCCTCCAGGGGG - Intergenic
916506939 1:165436640-165436662 TCCCAGGGCAGGCACTCATGAGG + Intronic
918346189 1:183609410-183609432 CTCCATAGCAGGCCACCAGGCGG + Intergenic
919548074 1:198949050-198949072 CCCCATCCCAGGGCCCCAGGGGG - Intergenic
919753837 1:201054366-201054388 CCCCAGGGCAGGCCCTGCTGAGG - Intronic
919777912 1:201206197-201206219 CCAGAGAGCAGGGCCCCAGGGGG + Exonic
919847542 1:201651020-201651042 CACCATGGCAGGCACCAAGGAGG + Intronic
921163217 1:212487477-212487499 CCCCAGGGCATGACCCCAGGGGG - Intergenic
921175031 1:212586043-212586065 CCCACGGGCAGGACCCCAGAGGG - Intronic
921346165 1:214187522-214187544 GCTCAGGGCAGGCGCCAAGGGGG + Intergenic
922534653 1:226370872-226370894 CCCCAGGGAAGGCCGCTGGGTGG - Intronic
922648759 1:227318612-227318634 GCCCAGCGGAGGCCCCCAAGGGG + Intergenic
924561200 1:245156941-245156963 CCACGGGGGAGGCCCCCAGGTGG + Intronic
1062834247 10:625502-625524 CCACAGGGCAGGCTCCCCGTAGG - Intronic
1063137377 10:3229348-3229370 TCCCAGGGAAGGCCCCGGGGAGG - Intergenic
1063881537 10:10537442-10537464 CCCCAGGGCAGGAGCCCAAATGG + Intergenic
1064600278 10:16985946-16985968 GCCTAGGCCAGGCCTCCAGGAGG + Intronic
1067077353 10:43195747-43195769 CCTGAGGGCAGGCGCCCAGGTGG + Exonic
1067088023 10:43253079-43253101 GCCCAGGGAGGGCCCACAGGCGG + Intronic
1067227697 10:44386307-44386329 CCCCAGGGCAGGCCCCTGGATGG - Intronic
1067469972 10:46528895-46528917 ACCCATGGCAGGCCCCACGGAGG - Intergenic
1068355802 10:55907137-55907159 CCACTGGGCAGTGCCCCAGGGGG + Intergenic
1068676800 10:59777487-59777509 CCACTGGGCAGTGCCCCAGGAGG + Intergenic
1069605096 10:69733829-69733851 CCCCAGGGCAGGGCACCCAGGGG - Intergenic
1069778744 10:70941814-70941836 CCCCAAAGCAGCCCCCCAGGTGG - Intergenic
1069978924 10:72238659-72238681 GCCCAGGGCAGGAGCCCATGAGG - Intergenic
1071055346 10:81503140-81503162 CCGCAGTGCAGGAGCCCAGGCGG - Intergenic
1072654339 10:97319772-97319794 GCGCAGCGCAGGACCCCAGGGGG - Exonic
1073150323 10:101306974-101306996 CCCCCGGGGAGGAACCCAGGAGG + Intergenic
1073481937 10:103791537-103791559 CCTGAGGGCAGGCCCCGAGGCGG + Intronic
1075032041 10:119030062-119030084 CCCCAGGCCCGGCCCCCGTGTGG - Exonic
1075266237 10:121001504-121001526 TCCCAGAGCAGGAGCCCAGGAGG - Intergenic
1075579077 10:123603315-123603337 CACAAGGCCAGGCCCGCAGGAGG + Intergenic
1075651384 10:124130006-124130028 CCCCAGATCAGCCCTCCAGGCGG - Intergenic
1075668610 10:124247953-124247975 CCCCAGGGCAGGGCCCAGAGGGG + Intergenic
1076052312 10:127345693-127345715 CACCTGTGCAGGCCCCAAGGTGG - Intronic
1076276547 10:129204329-129204351 CCCCAGGGAGGACCCCAAGGAGG + Intergenic
1076474339 10:130742088-130742110 CCCCAGCCCAGGCACCCAAGGGG + Intergenic
1076510589 10:131011434-131011456 CCCCAGTGCAGGTCCTCAGTTGG - Intergenic
1076849000 10:133083855-133083877 CCGCAGCTCAGGCCCCAAGGGGG + Intronic
1077009433 11:373642-373664 CCTCAGGGCTGGCCCTCAGGAGG - Intronic
1077183486 11:1226565-1226587 CCCCATGCCAGCCCCCCACGGGG - Intronic
1077186635 11:1238408-1238430 CTGGAGGGAAGGCCCCCAGGTGG + Intronic
1077325457 11:1962058-1962080 CTCTTGGGCTGGCCCCCAGGCGG + Intronic
1077453967 11:2666961-2666983 CTCCCGGGCGGGCCCCCAGAGGG - Intronic
1078023645 11:7674225-7674247 GCCCAGGGTAGGCGCCCATGAGG - Intronic
1078601238 11:12733068-12733090 GCCCAAGGCAGGCCCCCATGTGG - Intronic
1079129847 11:17741036-17741058 CCCCAGGCCAGGGCCCCACTTGG + Intronic
1079139385 11:17797918-17797940 CCCCAGGACAGTCCCACAGTGGG + Intronic
1080578510 11:33622357-33622379 CCACAGGGCTGGCCCTGAGGAGG + Intronic
1080871033 11:36237182-36237204 CAAAAGAGCAGGCCCCCAGGTGG - Intergenic
1081655776 11:44856481-44856503 CCCCAGGGAAGGCTTCCTGGAGG - Intronic
1081867348 11:46367022-46367044 GCCCAGGCCAGACCCACAGGAGG - Intronic
1083477413 11:62923201-62923223 ACCCAGGGCAGCCCAGCAGGGGG - Intergenic
1083610905 11:64003855-64003877 CACCAGGGCAGCCCCCCTGCTGG - Intronic
1083681561 11:64354065-64354087 CCCAGGCGCAGCCCCCCAGGGGG - Exonic
1083747338 11:64743477-64743499 CCCTAGGGCAGGCCCCCTGGGGG - Intronic
1083826236 11:65205536-65205558 CACCACAGCAGGGCCCCAGGAGG - Intronic
1084091654 11:66882805-66882827 CCCCAGGGCTGGCAGCCAAGAGG + Intronic
1084122747 11:67078679-67078701 CCAAAGGACAGGACCCCAGGAGG - Intergenic
1084167563 11:67382957-67382979 CCCCAGGGCAGGCATCAGGGAGG - Intronic
1084311346 11:68317918-68317940 CCCCAGGACAACCTCCCAGGGGG - Intronic
1084316871 11:68350627-68350649 ACCCTGGGCAGGCCCAGAGGAGG - Intronic
1084696260 11:70757386-70757408 CCGCAGGGCTGGCCCCTAGCTGG + Intronic
1086006803 11:82047459-82047481 CCCCTGGGCAGTGCCCCAGTGGG - Intergenic
1086552547 11:88069331-88069353 CCCCAGGGTGGGCTCCCACGTGG + Intergenic
1088582472 11:111329482-111329504 CCCCAGGGAAGGCCCAGAGTTGG + Intergenic
1088971591 11:114779330-114779352 CCCCAGGCCAGGGCCCCAGCAGG - Intergenic
1089558731 11:119332396-119332418 CACCAGAGCAGGCCTCCAGAGGG + Intergenic
1089757885 11:120699830-120699852 CCCCTGGGCATGCCCCGAGCTGG - Intronic
1090024463 11:123155898-123155920 CCCAAGGGGAGGCCCACATGGGG + Intronic
1090077114 11:123586529-123586551 CCCGAGGGCGGACCCCCAGAGGG - Intronic
1090799034 11:130159540-130159562 TCCCGGGGCAGGGCCCCTGGAGG + Exonic
1202808438 11_KI270721v1_random:17237-17259 CTCTTGGGCTGGCCCCCAGGCGG + Intergenic
1091556453 12:1577178-1577200 ACACAGGGCAGGCCCCCAGAGGG - Intronic
1091583580 12:1803178-1803200 GCCCAGGGCAGGCCCCAGGTGGG - Intronic
1095190977 12:39257516-39257538 TTGCAGGGCAGGTCCCCAGGTGG + Intergenic
1096178395 12:49538080-49538102 CCCCAGGGCAGCACCCCGCGCGG + Intergenic
1096398809 12:51288232-51288254 GCACAGGGATGGCCCCCAGGTGG - Intronic
1096631119 12:52927361-52927383 CCCCAGGGGAGGCCCAAGGGTGG - Intronic
1097019308 12:56008355-56008377 CCCCAGGGCAGACATCCAGACGG + Intronic
1098343059 12:69470933-69470955 CCCCAGGACAGACCCAGAGGAGG - Intronic
1098357740 12:69627250-69627272 CCCCAGGGCAGACATCCATGGGG - Intergenic
1101901446 12:108794015-108794037 CCCCAGGCAAGGCCCAGAGGAGG - Intronic
1101968883 12:109298851-109298873 CCCCAGGTCACGCAGCCAGGAGG - Intronic
1102016034 12:109648608-109648630 CCCCAGGGCTGGACACGAGGGGG + Intergenic
1102260016 12:111437890-111437912 CCCTGGGGCAGGCCCAGAGGAGG - Intronic
1102260023 12:111437905-111437927 CCCCAGGGCTGGGCCTCAGCTGG + Intronic
1102461100 12:113100054-113100076 CCTCAGGACAGGCCCCTAGGAGG + Exonic
1102535333 12:113576751-113576773 CCTCAGCTCAGGCCCCCAGTTGG - Intergenic
1102561793 12:113767438-113767460 CACCAGGCTAGGCCCACAGGGGG - Intergenic
1103412763 12:120724582-120724604 ACCCAGGGCTGGTTCCCAGGTGG + Intergenic
1103623271 12:122201375-122201397 CCCCAGGGCTGGCCCTCAGCAGG - Intronic
1103723279 12:122985950-122985972 GCCCAGGCCAGGCCTCCTGGCGG + Exonic
1103847940 12:123912428-123912450 CCCCAGGACAGACCCCCTGCGGG - Intronic
1104407851 12:128533321-128533343 CCCCTGGCCTGGCCCTCAGGAGG - Intronic
1104491785 12:129200638-129200660 CCACAGGGACAGCCCCCAGGAGG - Intronic
1104870826 12:131994292-131994314 GCCCCCTGCAGGCCCCCAGGTGG + Intronic
1104955473 12:132463145-132463167 CCCCTGGGCAAGCACCCAGAAGG + Intergenic
1105280614 13:18960615-18960637 TCACAGGGCAGGCCACCAGGAGG - Intergenic
1105673040 13:22642119-22642141 TCCAGGGGCAGGCCCCCAGCTGG + Intergenic
1105805730 13:23950796-23950818 TCCCAGGGCCAGCCCCCAGGAGG + Intergenic
1106104033 13:26718347-26718369 CAGCAGGGCAGGCACCCAGCAGG + Intergenic
1106629190 13:31452714-31452736 CCCCAGACCTGGCCACCAGGGGG + Intergenic
1107851818 13:44578010-44578032 CCCTAGGGCATCCCCCGAGGAGG - Intergenic
1108518367 13:51222923-51222945 CTCCAGGGCCGGACTCCAGGGGG - Intronic
1108686954 13:52827960-52827982 GCCCAGGGCAGGCCCACATCTGG - Intergenic
1110967197 13:81713943-81713965 CCACATGGCATGCCCCAAGGCGG - Intergenic
1111123038 13:83879347-83879369 CCCCACCGCAGGCACCCCGGGGG - Exonic
1112580599 13:100674268-100674290 ACCCAGGGCAGGCGGCCAAGCGG + Intronic
1112698315 13:101975272-101975294 CCCCAGGGCTGTCCTCCAGTGGG + Intronic
1113634886 13:111912707-111912729 CCCCATGGCGGGACCCCAGGAGG - Intergenic
1113914190 13:113861213-113861235 CCCCTGGGCAGGCTCCTACGAGG - Intronic
1117744931 14:58860172-58860194 CCCAACCTCAGGCCCCCAGGAGG + Intergenic
1118318055 14:64737592-64737614 ACACTGGGCAGGCCCCCAGCAGG - Intronic
1118746312 14:68776035-68776057 CCCCAGGACAGCCCACCACGTGG + Intergenic
1118772612 14:68952247-68952269 GCCCAGGGCTGGCCTCCAGCAGG - Intronic
1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG + Intronic
1119432576 14:74578107-74578129 GGCCAGGGCAGGCCTTCAGGTGG + Intronic
1121243806 14:92448734-92448756 CCTCTGGGCAGGCTCGCAGGGGG - Intronic
1121309534 14:92928139-92928161 CACCAGGGCAGGACCACTGGTGG + Intronic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121368673 14:93337488-93337510 CCCCAGGTCTGGGCCCCAGAAGG - Intronic
1121553692 14:94820620-94820642 CCCCAGGGCAAGCCACAGGGTGG + Intergenic
1122116609 14:99530704-99530726 CCCCTGGGAAGCACCCCAGGCGG - Intronic
1122157080 14:99756171-99756193 CCCCAGAGAAGGACCCCAGGAGG + Intronic
1122228299 14:100292301-100292323 CGCCAGGGCAGGCCCCGCAGGGG + Exonic
1122317745 14:100835805-100835827 CCTGAGGCCAGGCCCACAGGAGG - Intergenic
1122658518 14:103279102-103279124 CCCCAGGCCAGACCCCCGCGCGG + Intergenic
1122994644 14:105256467-105256489 CCCCAGGTCACAACCCCAGGTGG + Intronic
1123042076 14:105494394-105494416 CCCAAGGCCAGGCCCACATGGGG + Intronic
1123133339 14:106006140-106006162 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1123135734 14:106026198-106026220 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1123171650 14:106378338-106378360 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1123195363 14:106610837-106610859 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1123399896 15:19973858-19973880 CCCCAGAGCAGGAGCGCAGGAGG - Intergenic
1123583365 15:21736585-21736607 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1123585188 15:21753888-21753910 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1123620015 15:22179182-22179204 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1123621835 15:22196495-22196517 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1124251077 15:28106865-28106887 CACCAGGACAGGCCCGGAGGCGG - Intergenic
1124258313 15:28164004-28164026 CCCCAGTGCTGCCCTCCAGGAGG - Intronic
1124414910 15:29466671-29466693 CCCCAGGGGAGGGCCCGGGGAGG + Intronic
1124415036 15:29466976-29466998 CCCCAGGGGAGGGCCCGGGGAGG + Intronic
1124579581 15:30941676-30941698 CCCCATAGCAGGCCTCCAGGGGG + Exonic
1124983084 15:34582660-34582682 CCGCAGGACAGGCCCCTCGGCGG + Intronic
1125674029 15:41493349-41493371 CCCCAGGGCGTGCACCCAAGTGG - Intergenic
1127509860 15:59629692-59629714 CCCCATGGCTGGCCTCCAGAAGG + Intronic
1127919129 15:63479588-63479610 CCCTCGAGCAGGCCTCCAGGAGG + Intergenic
1128061720 15:64739575-64739597 ACCAAGAGCAGGCCCCCAGGTGG - Intergenic
1128083878 15:64872964-64872986 CCCCAGGCCAAAACCCCAGGAGG - Intronic
1128323552 15:66708386-66708408 CCCCAGGGCATTACCTCAGGTGG - Intronic
1128374680 15:67066357-67066379 CCCCCGGGCGGGCCCCCACCTGG - Exonic
1128462516 15:67881869-67881891 CCCCAGGGCTGGCTCTAAGGTGG - Intergenic
1129074820 15:72984822-72984844 CCATAGGGCAGGCCATCAGGAGG + Intergenic
1129478409 15:75803479-75803501 TCCCAAGGCAGAGCCCCAGGAGG + Intergenic
1129735451 15:77958969-77958991 TCCCAAGGCAGAGCCCCAGGAGG - Intergenic
1129836497 15:78710799-78710821 TCCCAAGGCAGAGCCCCAGGAGG + Intronic
1130547890 15:84869667-84869689 CCCCATCCCAGGCCTCCAGGAGG - Exonic
1132112996 15:99115971-99115993 CCCCTGGCCTGGGCCCCAGGAGG + Intronic
1132196261 15:99916716-99916738 CCCCAGTCAGGGCCCCCAGGAGG + Intergenic
1132342916 15:101089202-101089224 CCCCGCAGCCGGCCCCCAGGCGG - Intergenic
1132537698 16:491335-491357 CCTCGGGGCAGGCCCTCAAGGGG - Intronic
1132598695 16:764490-764512 CCCCAGGGCAGCGCTGCAGGCGG + Intronic
1132649695 16:1014844-1014866 TCCCGGGGCAGCCTCCCAGGAGG - Intergenic
1132834755 16:1947148-1947170 CTCCAGGGCAGGCTGCCTGGAGG - Intronic
1133224735 16:4335448-4335470 CGGCTGGGCAGGTCCCCAGGGGG + Intronic
1133803794 16:9107423-9107445 GCTCAGGGCAGGCCCTCTGGAGG + Intronic
1135135930 16:19885251-19885273 CCCCAGGCCACGCTCCAAGGGGG + Intronic
1136010836 16:27362696-27362718 CCCAAGTGCAGGGCCCAAGGAGG + Exonic
1136470163 16:30474336-30474358 CCCTGGGGCAGCCCCCGAGGCGG + Intronic
1136540569 16:30925677-30925699 TCCCAGGCCAGGGCCCCAGTGGG + Intronic
1137053862 16:35734367-35734389 TGCCAGGGCGGGCCCCCAAGCGG - Intergenic
1137056832 16:35750035-35750057 TGCCAGGGCAGGCCCCCACAGGG - Intergenic
1137057482 16:35752551-35752573 TGCCAGGGCAGACCCCCAGCGGG - Intergenic
1138095419 16:54207373-54207395 CTTCAGGGCGGGTCCCCAGGTGG - Intergenic
1138418420 16:56884488-56884510 CCCTAGGGCTGTCCCCCAAGAGG + Intronic
1138455988 16:57121047-57121069 CCCCAGAGCTGTCCCCCAAGAGG - Intronic
1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG + Intronic
1139961830 16:70722326-70722348 CCCCAGGCCAGGCCCCTCCGAGG + Intronic
1141092489 16:81139671-81139693 CACCAGGGCAGGCCTTGAGGGGG + Intergenic
1141425173 16:83940196-83940218 CCCCAAGGAAGGCTTCCAGGAGG + Intronic
1141637752 16:85323703-85323725 GTCCAGGGCCGGCCCCAAGGGGG + Intergenic
1141651395 16:85394944-85394966 ATCCAGGGAAGGCCCCCTGGAGG + Intergenic
1141775254 16:86118687-86118709 CCCCGGGGCTGGGACCCAGGCGG - Intergenic
1141909401 16:87048168-87048190 CCCCGGGGCAGCCCCCCGGGAGG + Intergenic
1142121710 16:88389805-88389827 CGACAGCGCAGTCCCCCAGGAGG + Intergenic
1142199116 16:88752812-88752834 CCCCAGGGCAGGCCCGTGGTGGG - Intronic
1142247643 16:88977159-88977181 GCGCAGGGCAGGGCCCCAGATGG - Exonic
1142815306 17:2420348-2420370 CCGCAGAGCAGGCCCACAGGGGG + Exonic
1142902105 17:3018476-3018498 CTGCAGGGCTGGCCCCGAGGAGG - Intronic
1142957854 17:3533313-3533335 GCCGAGCGAAGGCCCCCAGGCGG - Intronic
1143007456 17:3846158-3846180 CCCCAGGGCCGGCCCCGCCGGGG + Exonic
1143107378 17:4536484-4536506 CCCCAGGGCAGGGCTCACGGTGG - Intronic
1143316185 17:6035166-6035188 CCCCAGCTCAGGGCCCCTGGTGG + Intronic
1144514981 17:15911100-15911122 CCCCAGGGCAGGCAGCCTGTGGG + Intergenic
1144634730 17:16897779-16897801 CTGCAGGGCAGGATCCCAGGAGG - Intergenic
1144649321 17:16997554-16997576 CACCAGGGCTGTCACCCAGGAGG - Intergenic
1144742138 17:17589985-17590007 CCCTGGGGCAGGCCCCTAGATGG + Intronic
1144776470 17:17787519-17787541 CCCCAGGGAAGGCTGCCGGGAGG - Intronic
1144812489 17:18009456-18009478 CCAGAGGGCTGGCCCTCAGGAGG - Intronic
1145168812 17:20637211-20637233 CTGCAGGGCAGGATCCCAGGAGG - Intergenic
1145200746 17:20942296-20942318 CTGCAGGGCAGGATCCCAGGAGG - Intergenic
1145278376 17:21450507-21450529 CACCAGGGGAGCCCCACAGGTGG - Intergenic
1145401079 17:22533529-22533551 CACCAGGGGAGCCCCACAGGTGG + Intergenic
1145849058 17:28073326-28073348 CTCCTGGGAAGGGCCCCAGGTGG + Intronic
1146164728 17:30578616-30578638 CTGCAGGGCAGGATCCCAGGAGG - Intergenic
1146654452 17:34626803-34626825 CCCCGGGCCCGGCCCCCCGGCGG - Intronic
1146677336 17:34782466-34782488 CCCCAGGGCATGCCCAGATGTGG + Intergenic
1147261634 17:39212466-39212488 CCCCAGGGTGGGTCCCCTGGGGG - Intronic
1147438024 17:40429932-40429954 CCCCTGGGGAACCCCCCAGGGGG + Intergenic
1147464090 17:40597445-40597467 CCCCAGGACAGGAGCCAAGGAGG - Intergenic
1147760289 17:42793724-42793746 CCCCAGGTCAGACCCCTTGGTGG + Exonic
1148205262 17:45775808-45775830 ACCTAGGGCAGAGCCCCAGGTGG + Intergenic
1148227194 17:45907170-45907192 CCACAGGGCAGGCTGGCAGGAGG - Intronic
1148615204 17:48996292-48996314 CCCCAGGTCAGACCCGCGGGGGG - Intergenic
1148740776 17:49891082-49891104 CCTCAGGGCAGGCTTCCTGGAGG - Intergenic
1149630171 17:58115804-58115826 CCCCTGGGCTGGCCCCTGGGTGG + Intergenic
1149660337 17:58331430-58331452 GCCCAGGGCGGGCCCTCGGGGGG - Intergenic
1149894904 17:60421924-60421946 CCCCAGGGAAGGCCGCGGGGAGG + Intronic
1150428953 17:65100651-65100673 CCGCAGGGCAGGGCCCCGGGGGG - Intergenic
1150433451 17:65137208-65137230 CCGCAGGGCAGGGCCCCGGGAGG - Intergenic
1150522881 17:65888042-65888064 CCCCAGGGCATCCCACCAGGAGG + Intronic
1151356167 17:73559880-73559902 CCCCAGGGCTGGGCACCAGCTGG + Intronic
1151559496 17:74862788-74862810 CCCCAGCCCCGGCCCCCAGCAGG - Exonic
1151729955 17:75905137-75905159 GCCCATGGCTGGCCACCAGGGGG + Exonic
1151766908 17:76137527-76137549 CTCCACCGAAGGCCCCCAGGTGG + Exonic
1151903876 17:77035251-77035273 CCCTGGGCCAGGCCCCCACGTGG - Intergenic
1152082481 17:78196870-78196892 CCCCAGGGCAAGAACACAGGAGG - Intronic
1152381604 17:79945156-79945178 GCCCAGGGAAGGGCCCCAGTGGG - Intronic
1152404655 17:80089913-80089935 CCCAAGGGCTGGCACCCAGCAGG - Intronic
1152523423 17:80873589-80873611 CCCGGGGACAGGGCCCCAGGCGG + Intronic
1152666329 17:81571865-81571887 CCCCAGAACAGGCACCCAGGAGG - Intronic
1152702925 17:81828393-81828415 CTCCTTGGCAGGGCCCCAGGAGG - Intronic
1152814557 17:82399780-82399802 CCCCAGGGCGTGGCCCCAGCTGG - Intronic
1153766061 18:8376168-8376190 GCCCAGTGCAGGCCCACTGGTGG + Exonic
1154205001 18:12328687-12328709 CCCCAGTGCAGGTCCTCAAGAGG - Intronic
1154305696 18:13229210-13229232 GCCCATGGCAAGCCCTCAGGAGG - Intronic
1155438076 18:25833734-25833756 ACACAGGAAAGGCCCCCAGGAGG + Intergenic
1156466154 18:37348894-37348916 CCCCAGTGCAGCTCCCCTGGGGG - Intronic
1157386272 18:47261683-47261705 CCCTAGGGCAGTCCACTAGGAGG + Intergenic
1157745202 18:50129105-50129127 GCCCAGGCCAGGCCCCACGGTGG + Intronic
1160259174 18:77275131-77275153 CCCCATGCAAGGCCCTCAGGAGG - Exonic
1160924215 19:1535324-1535346 CCCCAGGACAGCCCCTCTGGGGG - Exonic
1161369797 19:3904513-3904535 CGGCAGGGCAGGCCAGCAGGCGG - Intronic
1161399118 19:4059775-4059797 CCTTAGGGGAGGCCTCCAGGAGG - Intronic
1161444532 19:4310886-4310908 CCCCAGGGCGGGGCCTCATGAGG - Intronic
1161567483 19:5011755-5011777 CCCCAGGGCTGACCCTCGGGTGG - Intronic
1161618520 19:5286111-5286133 CACCATGCCAGGGCCCCAGGTGG + Exonic
1161778958 19:6279147-6279169 CCGCAGAGCAGGGTCCCAGGGGG + Intronic
1161815700 19:6498585-6498607 CCCCAGGGCAGGACCACACCTGG - Intronic
1162500488 19:11050779-11050801 CCCCAGGGCAGGGCCCCTGAGGG + Intronic
1162828497 19:13269336-13269358 CCCAAGGGCAGGCACACAGCTGG + Intronic
1163174672 19:15556019-15556041 CCCCAGCACAGGCCACCGGGGGG - Intergenic
1163253583 19:16141352-16141374 CCCTTGGGGAGGCCCCCAGTAGG + Intronic
1163418576 19:17201701-17201723 ACACAGGGCAGGCCCCAATGTGG + Intronic
1163603994 19:18264387-18264409 GCCCAGGGAGGGCCCCCATGCGG + Exonic
1163632149 19:18423017-18423039 CCCGAGGGCAGGCACCCACCAGG - Intronic
1163642284 19:18468673-18468695 CCTCAGGCCAGGACCACAGGGGG - Intronic
1163644095 19:18478588-18478610 CTTCAGGCCAGGGCCCCAGGTGG + Intronic
1163676905 19:18659944-18659966 CCCCAGAGCAGACTCTCAGGCGG + Intronic
1164157476 19:22605360-22605382 CCCCAGGGCAGGACTGCAGGGGG - Intergenic
1164709322 19:30344128-30344150 CCCTAGGGCCTGCCCCCAGTTGG + Intronic
1165311268 19:35030623-35030645 CCCCGGGGCTGGGCCCCCGGCGG + Intergenic
1165420123 19:35718261-35718283 CCCGCGGGCCGGCCCACAGGCGG - Exonic
1165941360 19:39416279-39416301 CTCCATGGGAGGCCTCCAGGAGG - Intronic
1166908619 19:46134120-46134142 CCACAGGCCAGACCACCAGGTGG - Intergenic
1167240913 19:48342487-48342509 CCACAGCGCAGGGCCGCAGGAGG + Intronic
1167588142 19:50386687-50386709 GCACAGGGTGGGCCCCCAGGAGG - Intronic
1167643649 19:50694935-50694957 CCCCAGGGCTGGCCAGCTGGAGG + Intronic
1168187205 19:54708001-54708023 CCCCAGTGCAGGGGCTCAGGAGG - Intergenic
1168320843 19:55508677-55508699 CCACAGGCCATGCCCTCAGGAGG - Intronic
1168320865 19:55508751-55508773 CCACAGGCCATGCCCTCAGGAGG - Intronic
1168320886 19:55508824-55508846 CCACAGGCCATGCCCTCAGGAGG - Intronic
1168320908 19:55508898-55508920 CCACAGGCCATGCCCTCAGGAGG - Intronic
1168320929 19:55508971-55508993 CCACAGGCCATGCCCTCAGGAGG - Intronic
925927285 2:8679286-8679308 CTCTAGGGCAGGCCCCGCGGCGG - Exonic
926119666 2:10235168-10235190 CCCCAGTGCCAGGCCCCAGGGGG - Intergenic
926218453 2:10919839-10919861 CCCCAGGAGAGGCCCCACGGAGG + Intergenic
927053340 2:19350268-19350290 CTCCAGGGCTGGCCAGCAGGGGG + Intergenic
927151336 2:20198215-20198237 CCCCAGTGCAGGTCCTCAGCAGG - Intergenic
927263380 2:21117225-21117247 CCCCAGCACAGCCCTCCAGGTGG - Intergenic
927492481 2:23529747-23529769 CCCCAGAGCCAGCCCGCAGGTGG - Intronic
927600272 2:24434729-24434751 CCCCAGGCCTGGCCTACAGGAGG - Intergenic
927863883 2:26576675-26576697 ACTCAGAGCATGCCCCCAGGGGG - Intronic
928094927 2:28398626-28398648 CCCCCTGGCAGGCAGCCAGGTGG + Intronic
929870428 2:45754634-45754656 CCCAGGGGCAGGCCCTCAAGGGG - Intronic
929922820 2:46184670-46184692 CCCCATGGGGGGCCCTCAGGAGG + Intronic
930022364 2:47009142-47009164 TCCCAGGGCAGGGCCTCAGGAGG + Intronic
931517716 2:63059577-63059599 CCCCTGGGCCGGCCCCTCGGGGG + Intergenic
931626235 2:64258408-64258430 CCCCAGGGCAGGCAATCAAGGGG - Intergenic
932020815 2:68084540-68084562 TCACAGGGCAGGCCATCAGGAGG + Intronic
932618967 2:73254856-73254878 GGCCAGGGAAGGCCCCCTGGGGG + Exonic
932765173 2:74464864-74464886 CCCCAGGGCGGGCAGGCAGGCGG - Intronic
933686259 2:85143894-85143916 CCCCAGTGCAGTGCCCCAGAGGG + Intronic
933941108 2:87245876-87245898 TCCCAGGGAAGACCCCTAGGGGG + Intergenic
934500680 2:94858042-94858064 CCTGAGGCCAGACCCCCAGGCGG - Intergenic
934561558 2:95316133-95316155 GGCCATGGCAGGCCCCCAGAGGG - Intronic
934765876 2:96879754-96879776 CCCCAGGGCAGCTCTCCTGGAGG - Intronic
934946915 2:98549049-98549071 CCGCAGGGGAAGCCCACAGGAGG - Intronic
935129795 2:100253228-100253250 AGCCAGGGCAGGCCGCCAGATGG + Intergenic
935720766 2:105976998-105977020 CCCCACAGCAGGCCCCCAGCAGG - Intergenic
936315734 2:111422724-111422746 CCCCCAGGCAGGACTCCAGGGGG - Intergenic
936352033 2:111720136-111720158 TCCCAGGGAAGACCCCTAGGGGG - Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
937359476 2:121218901-121218923 CCCCTGGGCAGGTCCCAAGGAGG + Exonic
937814705 2:126238185-126238207 CCCCAGGGCTGGCTGCCAGAAGG - Intergenic
937884530 2:126890778-126890800 CCTCAGGGCAGGTCCTCAGCAGG + Intergenic
938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG + Intronic
941866816 2:170344026-170344048 CCTGAGGGCAGGAGCCCAGGTGG - Intronic
942128091 2:172847468-172847490 TCCCAGGGCAGGAGCCAAGGAGG - Intronic
942944407 2:181657120-181657142 GCGCAGGGCAGGGACCCAGGAGG + Intronic
943624106 2:190180347-190180369 TCCCAAGGCAGGCCCCGCGGGGG + Intronic
943704616 2:191021520-191021542 CCACAGGGCAGGCACTCAGAAGG - Intergenic
944173403 2:196803067-196803089 CACCACGCCAGGCCCCCGGGAGG + Intergenic
944596268 2:201264446-201264468 ACCCTGGGCAAGACCCCAGGTGG - Intronic
946101430 2:217328014-217328036 CCACAGGGCAGGCCAGCAGGCGG + Intronic
946405187 2:219488670-219488692 GCCTGGGGCAGGGCCCCAGGGGG + Intronic
946409504 2:219509125-219509147 CCCTAGGCCAGGCTGCCAGGGGG + Intergenic
946411163 2:219515780-219515802 CACCAGGCCAGCTCCCCAGGAGG - Intronic
946415423 2:219537676-219537698 CCCCAGTGGAGGTCCGCAGGGGG - Exonic
946470922 2:219960334-219960356 TCCCAGAGCAGGAACCCAGGCGG + Intergenic
948627773 2:239279722-239279744 CACCAGGCCAGGCCCGCAGGGGG + Intronic
948789996 2:240372205-240372227 CCCCTGGGCTGGCCACCAGAGGG + Intergenic
948816713 2:240514006-240514028 CCACAGCCCAGGCCACCAGGAGG + Intronic
948979538 2:241485796-241485818 CCCCAGGGCCCTCCCCCAGTAGG + Intronic
1168963764 20:1886544-1886566 CTCCAGGGCAGGCCTCACGGTGG - Intergenic
1169195679 20:3681021-3681043 CCCCAGGGGAGGGCCCCAGGCGG - Intronic
1170833968 20:19868069-19868091 CACCAAGCCAGGCCCCAAGGAGG + Intergenic
1171226222 20:23444142-23444164 CCCCAGGGCTGGGCCCCAGCTGG - Intronic
1172764549 20:37344626-37344648 GCTCAGGGCGGGCCCCCAGCTGG - Intergenic
1173000048 20:39099019-39099041 CACCAGGGCAGGCACCCAAAGGG - Intergenic
1173386188 20:42590171-42590193 CCCCAGTTGAGGCCCCCAGGTGG + Intronic
1173534830 20:43801465-43801487 CCCCAGGCCTGGCTCTCAGGAGG - Intergenic
1173868564 20:46328366-46328388 GCCCAGGGCGGGCCGGCAGGCGG - Intergenic
1174060167 20:47826879-47826901 CCCCGGGGCCTGCTCCCAGGTGG - Intergenic
1174071726 20:47904490-47904512 CCCCGGGGCCTGCTCCCAGGTGG + Intergenic
1174072028 20:47906054-47906076 CTCCAGGGCCTGCTCCCAGGTGG + Intergenic
1174147229 20:48460272-48460294 CCCCAGGGCCTGATCCCAGGTGG - Intergenic
1174152017 20:48492615-48492637 CCCCAGGGCCTGCTCCCAGGTGG - Intergenic
1174152322 20:48494145-48494167 CCCCGGGGCCTGCTCCCAGGTGG - Intergenic
1174173174 20:48629474-48629496 CCATCTGGCAGGCCCCCAGGCGG + Exonic
1174190719 20:48738574-48738596 CCCCATGTCGGGCCTCCAGGAGG - Intronic
1174481044 20:50831722-50831744 CCCAAGCCCAGGGCCCCAGGTGG - Intronic
1174528209 20:51190458-51190480 CCACAGGGCAGGACACCACGTGG - Intergenic
1175185002 20:57174066-57174088 CCTGAGGGCAGGCTCACAGGAGG + Intronic
1175256831 20:57652754-57652776 CCCCAGGCCAGGGCCCCCGCGGG - Intronic
1175518754 20:59586125-59586147 GGCCAGGGCAGGCCACCTGGAGG - Intronic
1176214824 20:63943058-63943080 CCCAAGGGCAGGCATGCAGGGGG - Intronic
1176374748 21:6081465-6081487 CCCCAGGAGACGCCCGCAGGTGG - Intergenic
1179469957 21:41603744-41603766 CGGCAGGGCAGGCCTCGAGGGGG - Intergenic
1179544487 21:42105255-42105277 CCACAGGGTATGCCCCCAGCAGG + Intronic
1179625285 21:42645797-42645819 CCGCATGGCAGCCTCCCAGGAGG + Intergenic
1179626385 21:42651948-42651970 CTGCAGGGCAGTTCCCCAGGAGG - Intergenic
1179643402 21:42761281-42761303 TCCCTGGGCAGGCTCCCAGCTGG + Intronic
1179712537 21:43271690-43271712 GCCCAGGTCGGGCCCCCAGCTGG + Intergenic
1179748727 21:43456780-43456802 CCCCAGGAGACGCCCGCAGGTGG + Intergenic
1179795130 21:43778139-43778161 CCCAAGGGCTGTCCCTCAGGGGG + Intergenic
1180082662 21:45493854-45493876 CCACAGGCCAGGCCCCAGGGAGG - Intronic
1180086237 21:45509207-45509229 CCCCAGGGCAGCCCCAGAGTCGG + Intronic
1180245327 21:46543544-46543566 CCCCCAGGCACTCCCCCAGGTGG + Intronic
1180595233 22:16968599-16968621 CCTGAGGGCAGGCATCCAGGAGG - Intronic
1180705128 22:17804785-17804807 CTCAAGGGGAGGCCCTCAGGTGG - Intronic
1180839281 22:18951365-18951387 ACCCAGGGCAGGGACCCAGAGGG + Intergenic
1181052697 22:20245342-20245364 CCAGCGGGCAGGCCCCAAGGGGG - Intronic
1181062610 22:20289091-20289113 ACCCAGGGCAGGGACCCAGAGGG - Intergenic
1181884265 22:26007200-26007222 CCCCAGGGCTGGCTCACAGTTGG + Intronic
1182104935 22:27682583-27682605 CTCCAGTGCAAGCCCCAAGGAGG - Intergenic
1182149570 22:28018653-28018675 TCCCAGGGCAGTTCCCCAGTGGG - Intronic
1182273373 22:29169887-29169909 CCCCAGAGCAGGCCCACCTGTGG - Intergenic
1182430627 22:30296967-30296989 CATCAGGGAAGGCCCTCAGGAGG + Intronic
1182435748 22:30328606-30328628 CCCCAAGGCAAGCCCCAAGAGGG + Intergenic
1182453043 22:30432536-30432558 CCCCAGGGCAGCCCATGAGGAGG - Intergenic
1183247304 22:36703584-36703606 TCCCAGGGCCGCCCGCCAGGAGG + Intergenic
1183653985 22:39174744-39174766 CCCCAGCGCAGGCCTCGATGGGG + Intergenic
1183713017 22:39517534-39517556 ACCCAGGAGAGGCCCCGAGGTGG + Exonic
1183740042 22:39664287-39664309 CCCCGGGGCTGGCACCCAGAGGG - Intronic
1183780192 22:39994738-39994760 CCTGAGGGGACGCCCCCAGGGGG - Intergenic
1184291963 22:43502231-43502253 CCCAAGGGCAGGCACCCTGGTGG - Intronic
1184478590 22:44734871-44734893 CCCCATGGCAGGGCCCACGGTGG - Intronic
1184596773 22:45518695-45518717 CCGCACAGCAGGCCTCCAGGAGG - Exonic
1184656188 22:45943394-45943416 CCAAGCGGCAGGCCCCCAGGTGG + Intronic
1184660506 22:45963498-45963520 CCCCACGGCGAGCCCCCAGTTGG + Intronic
1184844607 22:47073667-47073689 CCCCAGGGCAGGCAGCAGGGAGG + Intronic
1185046528 22:48531278-48531300 GCCCAGGACAGGCTCCCAAGAGG - Intronic
1185213887 22:49587528-49587550 CCCCAGCCCAGGCCAGCAGGTGG + Intronic
950183624 3:10931941-10931963 CCCCATGGCAGGCGCACAGGAGG + Intronic
950497068 3:13340182-13340204 CCCCAGTGCAGGCCACCACCTGG - Intronic
952967477 3:38630258-38630280 CCCCAGCGTGGGCCCCCAGGGGG + Intronic
954794354 3:53154051-53154073 CCCCTGGGCAGGATCCCAGTGGG - Intergenic
954894402 3:53963598-53963620 CCCACGGGCAGGCCCCCTCGAGG + Intergenic
960596697 3:119414021-119414043 CCACAAGGCAAGCTCCCAGGAGG - Exonic
961049374 3:123733826-123733848 CCCCAGGCCAGGCTGCCTGGTGG + Exonic
961078163 3:124000978-124001000 CTCCTGGGCTGGCTCCCAGGAGG - Intergenic
961644483 3:128385294-128385316 CCCCACTGCAGTCCCCCAGTCGG - Intronic
961743146 3:129046436-129046458 CTCCAGGGCAGGCCGCGAGCTGG - Intergenic
962197418 3:133376320-133376342 CCCAGGGACAGGCCCTCAGGTGG - Intronic
962226455 3:133614809-133614831 CCCCAGGACAGGCCCCGGTGTGG - Intronic
968519324 4:1028563-1028585 CCACAGGGCAGGGCCCCGGCAGG - Intergenic
968595615 4:1480907-1480929 CCCCAGGGCTGGCCACAGGGTGG + Intergenic
968703424 4:2067240-2067262 CCCCAAGGCATGCCACCAGCCGG - Exonic
968730341 4:2266437-2266459 CCCCAGGCCAGGCCTCTTGGGGG + Intergenic
968902756 4:3439095-3439117 CCCCTGAGGACGCCCCCAGGAGG + Intronic
968911090 4:3477322-3477344 CCCCAAACCAGGCCCACAGGAGG - Intronic
968968109 4:3779610-3779632 CCTCAGTGCAGGCCCACAGGAGG - Intergenic
969321769 4:6417020-6417042 CCCCAGTGCTGGACCCCAGCAGG - Intronic
969417295 4:7068981-7069003 CCCCGGTGCCGGCCCCCAAGCGG + Intergenic
969511748 4:7622065-7622087 CCCCAGAGCACGGCCCCTGGGGG + Intronic
969584178 4:8082444-8082466 CCGCACAGCAGGCCCACAGGGGG - Intronic
969713708 4:8858610-8858632 CCTGAGCGCAGGCCCCCGGGCGG + Intronic
969870388 4:10101018-10101040 GCCCAGGGCAGGCTTCCTGGAGG - Intronic
970364091 4:15341311-15341333 CCCAAGAGCAGGGTCCCAGGCGG - Intronic
976830268 4:89307568-89307590 CCCCCGCGCTGGCCGCCAGGCGG + Intronic
981932463 4:150205875-150205897 CCCCAGGCCATTGCCCCAGGTGG + Intronic
985391997 4:189499747-189499769 CCCCAGGTCAGGCCCCGGGCTGG - Intergenic
985629255 5:1006254-1006276 CCTCAGGGCATTCCCCCGGGTGG - Intergenic
985674615 5:1224621-1224643 TCCCAGGGCAGGGGCCCAGGTGG - Exonic
985728276 5:1526889-1526911 CCACAGGGCACGTGCCCAGGGGG + Intergenic
986826401 5:11527433-11527455 TTCCAGGGCAGGCTCCCAGAAGG - Intronic
989183938 5:38604752-38604774 CCCCATGGCACAGCCCCAGGAGG + Intronic
989366189 5:40658580-40658602 CCCCAGTGTAATCCCCCAGGAGG + Intergenic
992027064 5:72681159-72681181 CCCAACCTCAGGCCCCCAGGAGG + Intergenic
997398094 5:133580635-133580657 CTCCAGTGCCAGCCCCCAGGAGG - Intronic
997569736 5:134917264-134917286 CTCCAGGGCAGGAGCCCAGCCGG + Intronic
998139100 5:139689970-139689992 GCCCAGACCTGGCCCCCAGGAGG - Intergenic
1000014516 5:157265894-157265916 CCCCAGGGCAGGAAGCCTGGGGG + Intergenic
1000250896 5:159494386-159494408 CCCCAGAGCTGACTCCCAGGTGG + Intergenic
1000252203 5:159506394-159506416 CCACAGGGCAGGCCACTGGGTGG - Intergenic
1000995042 5:167950231-167950253 ATCCAGGGCTGGTCCCCAGGGGG - Intronic
1001287563 5:170435095-170435117 CCTCAGGCCAGGCTACCAGGAGG - Intronic
1001556947 5:172643016-172643038 CCCCAGGGCTGACCCACAGGTGG - Intronic
1001598910 5:172916275-172916297 CACCAGCCCAGGCCCTCAGGAGG + Intronic
1001605144 5:172954450-172954472 CCCCACCGCAGCCTCCCAGGTGG - Intergenic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002186486 5:177457078-177457100 CCCCACGCCAGGCCCCAAGCAGG + Exonic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1002329963 5:178434542-178434564 CCCCAGGGAAGGCCCCAGGCTGG - Intronic
1002568584 5:180127738-180127760 CACCACGGCAGGCCCCCCAGTGG - Intronic
1004533608 6:16477894-16477916 CATCTGGGCAGGCCTCCAGGAGG - Intronic
1005139608 6:22613235-22613257 GCCCAGGGCATCCCTCCAGGAGG + Intergenic
1005182342 6:23120127-23120149 CCCCAGGACAGGCCCCAGTGTGG + Intergenic
1005821567 6:29603607-29603629 CCCCTGGGCAGGCCCCCAGAGGG + Exonic
1006431568 6:34000459-34000481 CCCCAGGCCAGCACCCCTGGTGG - Intergenic
1006436346 6:34027802-34027824 CCCCGAGGCAGGCCACCAGGGGG - Intronic
1006515221 6:34541837-34541859 CCCCAGAGCAGCACCCCAGGGGG - Intronic
1006876702 6:37303793-37303815 CCCCAGGGAAGGCTTCTAGGAGG - Intronic
1006918455 6:37612008-37612030 CACGAGGGCAGGGCCACAGGAGG - Intergenic
1007226789 6:40320834-40320856 CAGCAAGGCAGGCCCCAAGGAGG - Intergenic
1007881265 6:45169972-45169994 CCACAGGGCACAGCCCCAGGGGG + Intronic
1009340008 6:62541984-62542006 CCCAATCTCAGGCCCCCAGGAGG - Intergenic
1010897049 6:81377682-81377704 CCCCAGAGCAGGTGCACAGGAGG - Intergenic
1011008740 6:82678958-82678980 CCCCAGTGCAAGCCCTAAGGTGG + Intergenic
1011517114 6:88166516-88166538 CCCCAGGGCTGGCGCCGCGGCGG - Intergenic
1012548009 6:100441336-100441358 CAGCAGGGGAGGCCCCCTGGGGG - Intronic
1012953021 6:105539119-105539141 CCCCCAGACAGGCCCCCATGTGG - Intergenic
1018378153 6:163232820-163232842 CCCCAGCTCACGCTCCCAGGAGG + Intronic
1018422632 6:163652662-163652684 CCCAAGGGCAGGACAGCAGGCGG + Intergenic
1018424345 6:163667151-163667173 CCCCTGGGCAGGCACACAGTGGG - Intergenic
1018429031 6:163709248-163709270 CCCCAGGTCATGCACCCAGGGGG - Intergenic
1018790938 6:167147179-167147201 CCGCAGGGCAGGCTGGCAGGCGG + Intronic
1018800449 6:167218087-167218109 CCACAGGGCAGGTCCCCCAGTGG + Intergenic
1019005608 6:168794137-168794159 CCTCAGGGCTGTCCCCCACGTGG - Intergenic
1019257364 7:60890-60912 TCCCAGGGCAGGGCCCACGGTGG + Intergenic
1019371910 7:666482-666504 TCCCAGGGCAGGCCCCAGGGTGG - Intronic
1019475861 7:1243969-1243991 CCCCAGGGCACCCCCCCAGAGGG + Intergenic
1019592715 7:1843769-1843791 CCCCACGGCAGGCCACGTGGAGG + Intronic
1020070501 7:5223883-5223905 GCACAGGGCGGGCCCACAGGTGG - Intronic
1020266247 7:6562036-6562058 CTCCAAGACAGGCCCCCATGTGG + Intergenic
1020692330 7:11371323-11371345 CCCCAGGTCCTGCCCTCAGGTGG - Exonic
1022802837 7:33792412-33792434 CCCCAGGGCAGGCCCCTGAGAGG + Intergenic
1023361691 7:39423433-39423455 CCCCATGCCAGGCACACAGGAGG + Intronic
1023703007 7:42911638-42911660 CCCCAGCGCAGGTCGCCGGGTGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1024054008 7:45648147-45648169 CCACAGGGCACACTCCCAGGAGG - Intronic
1024054886 7:45653641-45653663 CCCCAAGCCAGGCCCCAGGGAGG - Intronic
1024384786 7:48738893-48738915 CCACTGGGCAGTTCCCCAGGGGG - Intergenic
1025234757 7:57227142-57227164 CCCCGGGGCCTGCTCCCAGGTGG + Intergenic
1025235061 7:57228785-57228807 CCCCAGGGCCTGCTCCCAGGTGG + Intergenic
1025950300 7:66140098-66140120 CTCAAGGGCAGCCCCCCAGGTGG - Intronic
1026036215 7:66832324-66832346 CACCAGGGCAGACCCTCAGGAGG + Intergenic
1026545181 7:71316179-71316201 CCACAGATCAGGACCCCAGGCGG - Intronic
1026777645 7:73240676-73240698 CCCCAGGCCAGGAGCCCAGTTGG - Intergenic
1026795453 7:73363560-73363582 CCCCCACGCAGGTCCCCAGGTGG + Intergenic
1026983287 7:74538814-74538836 CACCAGGGCAGACCCTCAGGAGG - Intronic
1027018500 7:74794048-74794070 CCCCAGGCCAGGAGCCCAGTTGG - Intergenic
1027069529 7:75151870-75151892 CCCCAGGCCAGGAGCCCAGTTGG + Intergenic
1027214389 7:76174419-76174441 CACCAGGGCAGACCCTCGGGAGG - Intergenic
1029172293 7:98639689-98639711 CCCCAGGGCAGCCCTTCAGCTGG + Intergenic
1029269251 7:99366939-99366961 TCCCAGGGCAGGCTCCCATTCGG - Intronic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1030193405 7:106831433-106831455 CACCAGGGCAGTTCCCCAGGAGG + Intergenic
1032081149 7:128859077-128859099 ACCCAAGCCAGGCTCCCAGGGGG + Exonic
1032461365 7:132113938-132113960 CCCCAGGGTGGCCCCCCTGGTGG - Intergenic
1033660578 7:143399267-143399289 TCCCGGGGAGGGCCCCCAGGTGG - Exonic
1034099097 7:148436303-148436325 TCCCAGGGCAGGTGGCCAGGGGG + Intergenic
1034435569 7:151061352-151061374 CCCCAGTACAGGCCGGCAGGAGG - Intronic
1034959356 7:155355398-155355420 CCCCAGGCGAGCCCCCCAGAGGG + Intergenic
1035299318 7:157887017-157887039 CCCCAGGACAGGCCCGCTGTGGG - Intronic
1035382464 7:158448563-158448585 CCCCAGGGGAGCCCCTCAGCGGG + Intronic
1035395066 7:158529389-158529411 GCCCAGGGGAGGCCAGCAGGAGG + Intronic
1035557501 8:577889-577911 CCCCAGGCCAAGCTCCCAGGCGG - Intergenic
1035643913 8:1203911-1203933 CCCAGGGGCAGGCTCACAGGTGG - Intergenic
1035745040 8:1955804-1955826 CCCCTGGGCAAGCCCCCAGAAGG - Intronic
1035905532 8:3506059-3506081 CCCCAGGGCTCAACCCCAGGAGG - Intronic
1036711275 8:11080582-11080604 AGTCTGGGCAGGCCCCCAGGTGG + Intronic
1037930952 8:22880112-22880134 GCCCTGGGCAGAGCCCCAGGCGG - Intronic
1039421867 8:37450244-37450266 CTTCAGGCCAGGCCCTCAGGAGG + Intergenic
1040313992 8:46251311-46251333 CCCCAGGGCTGTCCCACCGGGGG + Intergenic
1041005698 8:53495291-53495313 CCACAGTGGAGGCCTCCAGGAGG - Intergenic
1045945396 8:107789257-107789279 CCACATCTCAGGCCCCCAGGAGG - Intergenic
1048291171 8:133182877-133182899 CCCCGGCCCAGGCCCCCAGGTGG + Intergenic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049058689 8:140258991-140259013 CCACAGGGCAGGACCCAAAGGGG - Intronic
1049266623 8:141671118-141671140 CCCCAGGGCAGGCCCACAGCGGG - Intergenic
1049381775 8:142319794-142319816 CCCCAGAACAGGCACCCAGCAGG + Intronic
1049476038 8:142797424-142797446 CACCAGGGCAGGAGCCCAAGGGG + Intergenic
1049545080 8:143226819-143226841 ACACTGGGCAGGACCCCAGGCGG - Intergenic
1049655858 8:143796971-143796993 CTCCAGCTCTGGCCCCCAGGAGG + Intronic
1049690746 8:143957826-143957848 CAGCAGGGCAGGCTGCCAGGGGG - Intronic
1049796612 8:144499983-144500005 GCCCAGGGCTGCCCCTCAGGAGG - Intronic
1049826262 8:144670699-144670721 GCTCAGGGCAAGCCTCCAGGAGG - Intergenic
1051314146 9:15810474-15810496 CCCCATGGCGGGCCCCCAAGTGG - Intronic
1052956592 9:34257214-34257236 CGCCAGTACAGGCCCCCAGAGGG - Exonic
1052970949 9:34376913-34376935 CCCCAGGGCGGGACCCGAGGAGG - Intergenic
1053656496 9:40222507-40222529 CCTGAGGCCAGACCCCCAGGCGG + Intergenic
1053906846 9:42851725-42851747 CCTGAGGCCAGACCCCCAGGCGG + Intergenic
1054194402 9:62015905-62015927 GCCCAGGGGAGGCCCTCAAGGGG - Intergenic
1054528120 9:66153778-66153800 CCTGAGGCCAGACCCCCAGGCGG - Intergenic
1054644005 9:67572785-67572807 GCCCAGGGGAGGCCCTCAAGGGG + Intergenic
1054676227 9:67858481-67858503 CCTGAGGCCAGACCCCCAGGCGG + Intergenic
1056701588 9:88915711-88915733 CCCCTGGGCAGGTTGCCAGGTGG - Intergenic
1056737056 9:89219144-89219166 CCCCAGAACAGACCCCCTGGTGG - Intergenic
1057272283 9:93657948-93657970 AAGCAGGGCAGGCCACCAGGAGG + Intronic
1057368377 9:94445887-94445909 CCCTAGGTCATGCCCTCAGGGGG - Intronic
1057693540 9:97307886-97307908 CCCCAGGGCAGGACTCCCCGGGG - Intronic
1057906547 9:98987824-98987846 ACCCAGGGCTGGCACCCAGCAGG - Intronic
1058682901 9:107455654-107455676 CCCCAGGGCAGGGCCCATGTTGG + Intergenic
1059483792 9:114611780-114611802 CCCAACCGCGGGCCCCCAGGAGG - Intronic
1060283160 9:122227352-122227374 CCCCAGGGCCGGGCCGCTGGAGG + Intronic
1061096146 9:128457494-128457516 CCCCAGGGCAGGCTCGCCTGAGG + Intronic
1061792313 9:133065086-133065108 CCCCATGGCCGGACCCCATGAGG - Exonic
1061792587 9:133066468-133066490 GCCCAGGCCTGGCCTCCAGGAGG - Intronic
1061865312 9:133489081-133489103 CCCCAGAGCAGGGCAGCAGGAGG + Intergenic
1061899264 9:133664655-133664677 CCCAAGGTCAGGGCCACAGGAGG + Intronic
1062046491 9:134426843-134426865 GCCAAGGGCAGGGACCCAGGGGG - Intronic
1062320931 9:135990254-135990276 CCCCAGGCCAGGCCCACAGCGGG - Intergenic
1062351565 9:136142205-136142227 GCCCAGGGCAGGCTCACAGTGGG + Intergenic
1062434386 9:136540261-136540283 CTCCAGGCCAGGCCCCCGGTGGG - Intronic
1062448336 9:136605005-136605027 GGCCTGGGCAGGCCCCCAGGCGG - Intergenic
1062549558 9:137079704-137079726 CACCAGGGCAGGTCCCCAGAAGG - Intronic
1062569546 9:137178829-137178851 CCCCAGGGCAGGAGGCCAAGGGG - Intronic
1062589708 9:137268013-137268035 CCCCCGTCAAGGCCCCCAGGAGG - Intronic
1062610584 9:137371674-137371696 CCCCAGGCCAGGCACCCCCGGGG + Intronic
1203794723 EBV:170141-170163 CCCCAGGAAAGACCCCCGGGGGG + Intergenic
1203795115 EBV:171202-171224 CCCCAGGAAAGACCCCCGGGGGG + Intergenic
1203795316 EBV:171740-171762 CCCCAGGAAAGACCCCCGGGGGG + Intergenic
1203748453 Un_GL000218v1:57687-57709 CCTGAGGCCAGACCCCCAGGCGG + Intergenic
1185593651 X:1294475-1294497 CCCCGGGGCTGGGCACCAGGAGG + Intronic
1186797620 X:13062160-13062182 CCACAAGGCAGTGCCCCAGGAGG + Intergenic
1187155870 X:16719944-16719966 CCCCAGGGCCGTCCCAGAGGAGG - Intronic
1189030200 X:37442108-37442130 CCCTGGGTCAGGCCACCAGGCGG + Intronic
1189516619 X:41718964-41718986 CCACAGGCCACGCCACCAGGTGG - Intronic
1192314935 X:70044034-70044056 CCCTGGGGCAGGCCCACAGTGGG - Intronic
1195786343 X:108527786-108527808 CCCAACCTCAGGCCCCCAGGAGG - Intronic
1197641822 X:128975914-128975936 TCCCAGGACAGGCCTGCAGGAGG - Intergenic
1197750004 X:129957621-129957643 CCCCAGGGAAGTCCGCCAGAGGG - Intergenic
1197796563 X:130305031-130305053 CCCAACGTCAGGCACCCAGGAGG + Intergenic
1198022140 X:132669475-132669497 CCACAGCCCAGGCCCCAAGGGGG + Intronic
1200166349 X:154038258-154038280 CCCCAAGGCTGTCCCCCAGGGGG + Intronic
1201579423 Y:15495286-15495308 CCTGAGGGCAGGTTCCCAGGAGG + Intergenic