ID: 1138583218

View in Genome Browser
Species Human (GRCh38)
Location 16:57955060-57955082
Sequence GACTTACCCCCAGAGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138583218_1138583222 3 Left 1138583218 16:57955060-57955082 CCACAGCCCTCTGGGGGTAAGTC 0: 1
1: 0
2: 2
3: 5
4: 157
Right 1138583222 16:57955086-57955108 CTGTCTAGCCTAAATCTTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1138583218_1138583224 13 Left 1138583218 16:57955060-57955082 CCACAGCCCTCTGGGGGTAAGTC 0: 1
1: 0
2: 2
3: 5
4: 157
Right 1138583224 16:57955096-57955118 TAAATCTTGCAGGCTGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 158
1138583218_1138583225 17 Left 1138583218 16:57955060-57955082 CCACAGCCCTCTGGGGGTAAGTC 0: 1
1: 0
2: 2
3: 5
4: 157
Right 1138583225 16:57955100-57955122 TCTTGCAGGCTGCCCATGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138583218 Original CRISPR GACTTACCCCCAGAGGGCTG TGG (reversed) Intronic
900488992 1:2936982-2937004 GATTTACCCCACGGGGGCTGGGG - Intergenic
901781656 1:11598413-11598435 TACCTATCCTCAGAGGGCTGTGG + Intergenic
902650247 1:17832672-17832694 GACATACCCCCAGGGAGGTGGGG + Intergenic
903243904 1:22001915-22001937 GAAAGACCCCCAAAGGGCTGTGG + Intronic
903499831 1:23794853-23794875 CACCTGCCCCCAGAGGCCTGTGG - Exonic
906697780 1:47836335-47836357 GACTGACCTCCAGTGGACTGTGG + Intronic
907600112 1:55760590-55760612 GACCTACCCCCACAGAGCTCAGG + Intergenic
912492784 1:110071000-110071022 CACTTGCCCCTAGAGGGGTGAGG + Intronic
922675277 1:227545626-227545648 GATTTACCCCAGGAGGGGTGGGG - Intergenic
922706655 1:227793988-227794010 CTCTTGGCCCCAGAGGGCTGGGG - Intergenic
922778170 1:228227116-228227138 GCCTTCACCCCAGAGGGCCGTGG + Intronic
1062982553 10:1737332-1737354 GACTTGCTCCCACTGGGCTGGGG + Exonic
1064233317 10:13549176-13549198 GACTTACCCCCAAAGATATGTGG + Intergenic
1066601925 10:37118493-37118515 GAATTACTCCCAGATGGCAGTGG - Intergenic
1067085102 10:43234042-43234064 CCCTCACCCCCAGAGGTCTGGGG + Intronic
1069746855 10:70720585-70720607 GGGTCAGCCCCAGAGGGCTGGGG + Intronic
1070789871 10:79182591-79182613 CACTTTCCCCCAGAGGGGTTTGG - Intronic
1071100141 10:82027315-82027337 CACTTACCACCAAAAGGCTGGGG - Intronic
1072332573 10:94368169-94368191 AACTTACCTACAGAGTGCTGTGG + Intergenic
1072564490 10:96606307-96606329 GGCTTAGCCACAGAGGGATGGGG - Intronic
1075397564 10:122138973-122138995 GACTCATCCCCAGAGAGCTCAGG + Intronic
1076358808 10:129872123-129872145 AACCTAACACCAGAGGGCTGGGG + Intronic
1080445141 11:32331516-32331538 GACTTTCCCCCAGAGGCCTGGGG - Intergenic
1080996831 11:37613248-37613270 GACTTTCCCACAGAGGACAGAGG + Intergenic
1083265401 11:61544537-61544559 GACCTGCCCCCAGGGAGCTGTGG - Intronic
1084436969 11:69148628-69148650 GACCAACCCGCTGAGGGCTGAGG - Intergenic
1085101312 11:73802781-73802803 CACTTGGACCCAGAGGGCTGAGG - Intronic
1085259118 11:75194191-75194213 GACTTCCTCCCGGAGGGCAGAGG - Intronic
1085347389 11:75777017-75777039 AAGTTACCCCCAAAGAGCTGAGG - Intronic
1088982243 11:114874390-114874412 GAAGTACCCCCAAAGAGCTGGGG + Intergenic
1089695242 11:120212364-120212386 GCCTTGCACCCAGGGGGCTGGGG + Intronic
1091109634 11:132953760-132953782 GACCTGCCCCCTGAGAGCTGGGG + Intronic
1092108456 12:5941845-5941867 GAGTGATACCCAGAGGGCTGGGG + Intronic
1096622994 12:52876012-52876034 GTCTTAGGCCCAGAGGGCAGAGG - Intergenic
1098783750 12:74722786-74722808 GACTGACCCCCAGAGTGCACTGG + Intergenic
1111143612 13:84154364-84154386 TACTTAGCCCCAGAGAACTGGGG + Intergenic
1111945092 13:94656568-94656590 CACTTGAACCCAGAGGGCTGAGG + Intergenic
1112282845 13:98077631-98077653 CACTTGAACCCAGAGGGCTGAGG + Intergenic
1112404472 13:99106657-99106679 GACTTGAGCCCAGAAGGCTGAGG + Intergenic
1113942179 13:114024035-114024057 GCCTTACGGCCAGAGGGATGCGG + Intronic
1114473642 14:22980192-22980214 GGCTTACCGCCTAAGGGCTGTGG - Intronic
1115354252 14:32430765-32430787 AACTTACCCCCAGAGGGCAGTGG + Intronic
1115641005 14:35335611-35335633 GACTAGGCCCCAGAGGGGTGGGG + Intergenic
1115887253 14:37986221-37986243 GCCTTTTCCCCAGAGGGCAGAGG + Intronic
1122899760 14:104777592-104777614 CACGTACACCCTGAGGGCTGTGG + Intronic
1202840096 14_GL000009v2_random:113943-113965 TAATGACCCCCAGAGTGCTGAGG + Intergenic
1202909479 14_GL000194v1_random:104140-104162 TAATGACCCCCAGAGTGCTGAGG + Intergenic
1123945112 15:25235166-25235188 GGGTGACCCCCAGAGGGATGTGG - Intergenic
1125448405 15:39782718-39782740 CACTTACCCCCAGAGGAGAGGGG + Exonic
1125633492 15:41167825-41167847 CACTTAACCCCAGAGGGTGGAGG + Intergenic
1127770253 15:62224698-62224720 GGCTCAGCCCCAGATGGCTGAGG - Intergenic
1127874075 15:63097616-63097638 GACTCACCCCCAGACGCCTATGG + Intergenic
1128798773 15:70483654-70483676 GATTCCCACCCAGAGGGCTGTGG - Intergenic
1129411818 15:75354559-75354581 GCCTTACCCTAAGAGGGCGGGGG + Intronic
1131507847 15:93032183-93032205 CACTGACCACCCGAGGGCTGAGG + Intergenic
1132219152 15:100092163-100092185 AACTTACCCCCAGCAGGCTAGGG + Intronic
1132384861 15:101393150-101393172 AACTCATTCCCAGAGGGCTGAGG + Intronic
1135153870 16:20035308-20035330 TACTTATTCCCAGTGGGCTGGGG + Intronic
1136128812 16:28205605-28205627 AACTGACTCCCAGAGGGCAGGGG + Intronic
1137012065 16:35331303-35331325 GACTTACCACCCCATGGCTGAGG + Intergenic
1137016421 16:35380066-35380088 GACTTACCACCTCATGGCTGAGG + Intergenic
1138583218 16:57955060-57955082 GACTTACCCCCAGAGGGCTGTGG - Intronic
1140654010 16:77121290-77121312 GATTTTGCCCCAGAGGTCTGTGG - Intergenic
1143734201 17:8899111-8899133 GGCTGAGCCCAAGAGGGCTGTGG + Intronic
1144579452 17:16450211-16450233 GCCTGAGGCCCAGAGGGCTGGGG + Intronic
1146833613 17:36091818-36091840 GACCTTCCACCAGAGGGTTGGGG + Intergenic
1146848196 17:36198647-36198669 GACCTTCCACCAGAGGGTTGGGG + Intronic
1146917412 17:36687038-36687060 GCCTTGCCCCCAGAGGGCCTAGG + Intergenic
1148343670 17:46889351-46889373 GTCTGACCCCCAGAGAGCTGTGG + Intergenic
1150590768 17:66560164-66560186 GGCATACCCCCAGAGGCTTGAGG + Intronic
1157401504 18:47392507-47392529 GACAGACCCCCAGAAGACTGAGG - Intergenic
1157514104 18:48298702-48298724 GACTATACCCCAGAGGGCTCCGG - Intronic
1160747138 19:717320-717342 GACTGGCTCCCCGAGGGCTGGGG - Intronic
1162156946 19:8684659-8684681 TTCCTACCCCCCGAGGGCTGTGG + Intergenic
1167149438 19:47700393-47700415 GATTTACCCCCAGTGGGTTTGGG + Intronic
925162779 2:1697720-1697742 GACGTCTCCCCAGGGGGCTGAGG + Intronic
929094064 2:38247313-38247335 GCCTGACCCACAGATGGCTGTGG + Intergenic
929501354 2:42493854-42493876 GGCCGACCCCCTGAGGGCTGCGG + Exonic
929696911 2:44125322-44125344 GACTGATCCCCAGAGAGATGAGG + Intergenic
930716059 2:54595330-54595352 GAGATACCCCCAGAGGGCAGGGG + Intronic
932621329 2:73266222-73266244 GAGATAGCCCCCGAGGGCTGGGG + Intronic
933808002 2:86014070-86014092 GACTTACCCTAAGAGCACTGAGG + Intergenic
934742886 2:96738710-96738732 GACTAAGCCCCGGAGGCCTGAGG - Intronic
939682717 2:145158474-145158496 AACTTAGTCTCAGAGGGCTGGGG - Intergenic
941886602 2:170534527-170534549 CACTTAAGCCCAGAAGGCTGAGG - Intronic
942306373 2:174611316-174611338 GACTAACCCCCAAAGGACTTTGG - Intronic
945940532 2:215944922-215944944 AACTTACCCCAAGAAGCCTGGGG - Exonic
946164221 2:217854069-217854091 GACTTCCACTCAGAGGCCTGGGG + Intronic
949057581 2:241936840-241936862 GACCTCCCCTCCGAGGGCTGCGG - Intergenic
1168893632 20:1309501-1309523 GCCTGACCCCAAGAGGGCAGTGG - Intergenic
1170593000 20:17785412-17785434 TACATAACCCCAGAGGCCTGGGG + Intergenic
1171984069 20:31647116-31647138 GAATAACCCTCAGAGGGCTAAGG + Intergenic
1172319309 20:33983809-33983831 CACTTAGGCCCAGAGGGTTGAGG + Intergenic
1174858641 20:54069742-54069764 AACTGAGGCCCAGAGGGCTGAGG + Intronic
1176628830 21:9118848-9118870 TAATGACCCCCAGAGTGCTGAGG + Intergenic
1180782685 22:18529709-18529731 GACTTACCGCCCCAGGTCTGGGG - Exonic
1181126245 22:20703736-20703758 GACTTACCGCCCCAGGTCTGGGG - Intergenic
1181239575 22:21469047-21469069 GACTTACCGCCCCAGGTCTGGGG - Intergenic
1181910100 22:26231788-26231810 TGCTTAGCCACAGAGGGCTGGGG - Intronic
1183719079 22:39551741-39551763 GGCTTCTCCCCACAGGGCTGGGG + Intergenic
1184554270 22:45224880-45224902 GTGTTATCCCCAGAGGGCTGGGG + Intronic
950549802 3:13659242-13659264 GAATTATTCCAAGAGGGCTGTGG - Intergenic
951754697 3:26077343-26077365 GGCCTACCCCAAGAGAGCTGTGG + Intergenic
953844288 3:46415024-46415046 GTCTGACCCCCAGAGGTCTTTGG + Intergenic
954693665 3:52409506-52409528 CCCTTACACCCAGAGTGCTGGGG - Intronic
954994621 3:54870198-54870220 AACTGACCCCCAGTGGGATGAGG - Intronic
955573477 3:60332517-60332539 TTCTTTTCCCCAGAGGGCTGTGG + Intronic
955864202 3:63365117-63365139 CACATACCAGCAGAGGGCTGTGG + Intronic
956963016 3:74424838-74424860 GACTTACCTCCAGAGTGTGGTGG + Exonic
961715327 3:128853730-128853752 GACTTCCCCTCTGTGGGCTGGGG + Intergenic
961924681 3:130465285-130465307 GAGTAAACCCCAGAGGTCTGTGG + Intronic
962243389 3:133770557-133770579 CACTTACCCCCAGTGTTCTGTGG - Exonic
966838514 3:184068521-184068543 GCCTCACCCCCAGTGGACTGAGG + Intergenic
968009483 3:195264396-195264418 GAGTCCCGCCCAGAGGGCTGTGG + Intronic
968686348 4:1961776-1961798 CACGCACCCCCACAGGGCTGTGG - Intronic
978020432 4:103803627-103803649 TATTTTCTCCCAGAGGGCTGTGG + Intergenic
979280746 4:118865021-118865043 ACCTTGCCCCCAGAGGTCTGAGG + Intronic
980608815 4:135129468-135129490 CACTTACCCCCAAAAGGCAGTGG - Intergenic
982826638 4:160010875-160010897 GCCCTGCCCCCAGAGTGCTGGGG + Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
985252844 4:188041260-188041282 GACTTCCACACAGAGGGCTTAGG + Intergenic
986840270 5:11688318-11688340 GAGTAACCCACAGAGTGCTGGGG - Intronic
987509654 5:18820031-18820053 GAATTACTCCCAGATGGCAGTGG - Intergenic
989167885 5:38448404-38448426 AATTTACCCCCAGAAAGCTGAGG - Intronic
989268287 5:39502888-39502910 GACTTGCCCAAAGGGGGCTGAGG - Intergenic
996853886 5:127983100-127983122 GTCTTCCCCCCCGAGGTCTGGGG + Intergenic
998104230 5:139458036-139458058 GCCTTAACCTCAGGGGGCTGGGG - Intronic
999251937 5:150188008-150188030 GACTTTCCCCACCAGGGCTGTGG + Intergenic
1000033639 5:157424881-157424903 ACCTTGCCCCCAGAGGGGTGGGG - Intronic
1002365538 5:178706773-178706795 GAAATATCCCCTGAGGGCTGTGG - Intergenic
1003026893 6:2562972-2562994 CACTTTCCCCCAGAGCCCTGGGG - Intergenic
1003570281 6:7252033-7252055 GACCTGCCCCAAGTGGGCTGTGG - Intergenic
1003596093 6:7475503-7475525 CACTTGACCCCAGAAGGCTGAGG - Intergenic
1006896350 6:37473586-37473608 GACTTACCCCCAGGCCGATGAGG - Exonic
1010756179 6:79668432-79668454 GACTCACCCCCACAGGGCCCTGG - Intronic
1015798027 6:137032447-137032469 GACTTGCCCACAGAGGGCAGTGG + Intronic
1017508439 6:155090364-155090386 AACTTACCCACAGAGGAATGTGG - Exonic
1018998033 6:168725017-168725039 CACTTTCCCCCAGAGAGCTGAGG + Intergenic
1023132035 7:37013087-37013109 AGCGTACCCCCAGAGGGATGAGG + Intronic
1023525419 7:41097331-41097353 GCCTAACTCCCAGAGGGGTGGGG - Intergenic
1024557447 7:50615603-50615625 CACTTACCATCTGAGGGCTGTGG - Intronic
1026661328 7:72305178-72305200 GACTGGCCCCCAGAGAACTGCGG + Intronic
1029592771 7:101518304-101518326 CTCTGAACCCCAGAGGGCTGAGG - Intronic
1030061385 7:105624068-105624090 GGCCTACCGCCAGAGGTCTGGGG + Exonic
1030203135 7:106925969-106925991 CACTTACGCCCAGGAGGCTGAGG + Intergenic
1030440129 7:109579119-109579141 GGCTTAGACCCAGAGGGTTGGGG - Intergenic
1032265517 7:130367632-130367654 GTCATACTCCCAGAGGGCTCAGG + Intronic
1035979967 8:4359679-4359701 CACTAAAACCCAGAGGGCTGAGG - Intronic
1036696222 8:10976870-10976892 GCCTGAGCCCCAGTGGGCTGGGG + Intronic
1039984790 8:42437962-42437984 CACTTATCTCCAGAAGGCTGGGG + Intronic
1045032320 8:98148962-98148984 GTCCTACTCCCAAAGGGCTGGGG + Exonic
1047116236 8:121844370-121844392 TACTTTCCCCCAGGGGTCTGTGG - Intergenic
1048295894 8:133212974-133212996 GGCTGACCCCCAGCGGGCAGCGG - Exonic
1052354950 9:27494596-27494618 CACTTAAACCCAGAGGGCGGAGG - Intronic
1058829774 9:108805884-108805906 GACCTATCCCCAAAGGTCTGTGG - Intergenic
1061160134 9:128889046-128889068 GACCAAGCCCCAGAGGGATGAGG + Intronic
1061823051 9:133239139-133239161 GCCGTGCCCCCAGAGGGCTTTGG - Intergenic
1061824922 9:133252186-133252208 GACTTTGCCCAGGAGGGCTGGGG - Intronic
1203751678 Un_GL000218v1:86529-86551 TAATGACCCCCAGAGTGCTGAGG + Intergenic
1189357564 X:40322947-40322969 TAATTACCCACAGATGGCTGTGG + Intergenic
1191645033 X:63470901-63470923 GCCTTACCCTCAGACGTCTGAGG + Intergenic
1191716610 X:64198032-64198054 GACTTACCCACAGAGCCCTAGGG - Intronic
1199413695 X:147555520-147555542 GACTAACCCCGAGAGGGCCCAGG - Intergenic
1199815887 X:151396801-151396823 GACTACCAGCCAGAGGGCTGTGG - Intronic
1201165335 Y:11204149-11204171 TAATGACCCCCAGAGTGCTGAGG + Intergenic