ID: 1138585896

View in Genome Browser
Species Human (GRCh38)
Location 16:57970300-57970322
Sequence TTAGCTCAGCCCTGGCTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138585896 Original CRISPR TTAGCTCAGCCCTGGCTCTC GGG (reversed) Intronic
900298823 1:1966402-1966424 TTAGCTGAGCCCGAGATCTCTGG - Exonic
900471549 1:2857497-2857519 TGAGCTCAGCCCTGGACCCCAGG - Intergenic
902834119 1:19035798-19035820 TGAGCTGCGCCCTGGCTCTGGGG - Intergenic
902942206 1:19808563-19808585 ATATCTCAGCCCTGTCCCTCGGG + Intergenic
903556237 1:24195749-24195771 TTGGCTCAGCCCTTCATCTCGGG + Intergenic
905032864 1:34899549-34899571 AGAGCTCAGGCCTGGCTCTGGGG - Intronic
905855879 1:41313517-41313539 TTAGCTCAGTTCTGCTTCTCTGG + Intergenic
906346577 1:45019332-45019354 TGAGCTCAGCCGTGGCCATCTGG + Intronic
907304715 1:53507101-53507123 GCAGCTCAGCCCTTGCCCTCAGG + Intronic
907552440 1:55315803-55315825 TTTGCTCACCCCTGGCCCTCTGG + Intergenic
907555164 1:55337074-55337096 AGAGCTCAGCCCCGGCACTCTGG - Intergenic
907995274 1:59625031-59625053 TTTACACAGCCCTAGCTCTCAGG + Intronic
908725129 1:67167569-67167591 TTAGCTCAGCCCAGGCACCATGG + Intronic
909781007 1:79547476-79547498 TCAGCTCTTCCCTGCCTCTCCGG + Intergenic
911034507 1:93526566-93526588 TTACCTCTGCCCTGGCTGTGGGG + Intronic
914214066 1:145608339-145608361 TTCCCTCAGCCCCGGCTGTCAGG + Intronic
914466010 1:147928742-147928764 TTCCCTCAGCCCCGGCTGTCAGG + Intronic
914751361 1:150537305-150537327 TTAGCTCATACCTGGTTCACAGG + Intergenic
915633724 1:157172149-157172171 ATGGCTCAGCCCTGTTTCTCCGG + Intergenic
915637549 1:157197103-157197125 ATGGCTCAGCCCTGTTTCTCCGG + Intergenic
915657992 1:157377457-157377479 ATGGCTCAGCCCTGTTTCTCTGG + Intergenic
916677071 1:167073086-167073108 TTAGCATAGCCCTTGCTCTGAGG - Intronic
916749906 1:167714404-167714426 TTTCCTCAGCCCGGGCTCCCGGG + Intergenic
916887995 1:169088766-169088788 TTACCTCTGCCCTGGCTTTAGGG - Intergenic
917521111 1:175749191-175749213 CCAGCTCAGCCCTGGCTTTAGGG - Intergenic
918110655 1:181452557-181452579 CTACCTCAGCCAGGGCTCTCAGG + Intronic
918313921 1:183306942-183306964 TTAGCACAGCACCGGCACTCAGG + Intronic
920529839 1:206693847-206693869 ATAACTGGGCCCTGGCTCTCAGG + Intronic
920853260 1:209643545-209643567 TTTGCCCTCCCCTGGCTCTCTGG - Intronic
922482373 1:225947924-225947946 TTTGCTCATCGCTGGTTCTCCGG + Intergenic
923628809 1:235636137-235636159 ACAGCCCAGCCCTGTCTCTCAGG - Intronic
1065871627 10:29960823-29960845 TTTCCACAGACCTGGCTCTCTGG - Intergenic
1071304982 10:84291605-84291627 CTAGGACAGCACTGGCTCTCTGG - Intergenic
1072549835 10:96469132-96469154 TGAGCCCAGCCCTGGCTCTGGGG + Intronic
1072657838 10:97342834-97342856 TGAGATCAGCGCTGGCTCTGAGG - Intergenic
1072758643 10:98038003-98038025 TTGGCTCAGCCCTGCCTCCATGG + Intergenic
1075439912 10:122471740-122471762 AAGGCTCAGCCCTGGGTCTCAGG - Intronic
1075723829 10:124601804-124601826 TTGCCTCAGGCCTGGCTCCCCGG + Intronic
1076189288 10:128471321-128471343 TCAGCTCAGCCCTGCCACGCCGG + Intergenic
1076499180 10:130922720-130922742 TTAACTTAGCCCTGACTTTCAGG - Intergenic
1077266436 11:1653100-1653122 TGAGCTCATCCCTGGCATTCAGG + Intergenic
1077380786 11:2236354-2236376 TTAGCTCAGATCTGACTCTGTGG + Intergenic
1077384221 11:2261436-2261458 TGAGCCCAGCCCAGCCTCTCAGG + Intergenic
1077400991 11:2357328-2357350 TTAGCTCAGGTCTGACTCTGTGG + Intergenic
1077909058 11:6558463-6558485 TTAGCTGAGCCCTGGCCCACAGG + Exonic
1079669442 11:23148940-23148962 TAAGCCCAGCACTGTCTCTCAGG - Intergenic
1084026542 11:66453887-66453909 AGATCTCAGCCCTGCCTCTCTGG + Intronic
1084230610 11:67750056-67750078 ATGGCACAGCGCTGGCTCTCAGG + Intergenic
1084276560 11:68054291-68054313 CCAGCCCAGCCCTGCCTCTCAGG + Intronic
1086917814 11:92551112-92551134 GGAGCTCAGCCCTGCCTCACAGG - Intronic
1088864181 11:113831050-113831072 TTAGATCATACCTGGCTCTTTGG - Intronic
1089142070 11:116293417-116293439 TTAGCTCATCCCTGTCTTACAGG + Intergenic
1089213675 11:116822768-116822790 TGACCTCAGCCCTGGCTCCTGGG + Exonic
1089425580 11:118371648-118371670 TTACCTCTTCCTTGGCTCTCTGG - Exonic
1089686204 11:120148253-120148275 TTAGATTAGCCCTGGGGCTCAGG - Intronic
1091647373 12:2284113-2284135 CTAGCTCGTCCCTGGCCCTCAGG + Intronic
1091699969 12:2652774-2652796 CCAGCTCAGCCCAGGCTCTGGGG + Intronic
1091752788 12:3033083-3033105 TTTTCTCAGTCCTGGCTCCCAGG + Intronic
1097750556 12:63347805-63347827 TGAGCTGAGCTCTGGCTCTTAGG - Intergenic
1099813733 12:87619247-87619269 TTAGCTCACCACTGGGTCTTAGG - Intergenic
1100185432 12:92133977-92133999 TTAGCACAGTCCTGACACTCAGG + Intronic
1101477526 12:105064733-105064755 TTGACTCAGCCCAGGCTCTCAGG - Intronic
1101954463 12:109201031-109201053 ATAGCACAGTCCTGGCTCTGCGG + Intronic
1103333781 12:120173780-120173802 CTGTCTCAGTCCTGGCTCTCTGG - Exonic
1104031451 12:125067997-125068019 TCAGCTCTGCCCTGGGTCCCTGG + Intronic
1104462375 12:128966213-128966235 TCAGCTCAGCCCTGGCTCCCAGG - Intronic
1104933273 12:132351652-132351674 TGAGCACAGCCGTGGCCCTCTGG + Intergenic
1105839445 13:24241295-24241317 TTTTCTCAGGCCTGGCTCTTAGG - Intronic
1111773470 13:92628512-92628534 CATGCTCAGCCCTAGCTCTCAGG + Intronic
1111845099 13:93497844-93497866 CAAGGACAGCCCTGGCTCTCTGG - Intronic
1112640427 13:101267734-101267756 TGAGCTCACCCCTGCCTCTGCGG - Intronic
1117951971 14:61091782-61091804 TTGGCGCAGCCCTGGCTCTGTGG + Intergenic
1118836550 14:69482423-69482445 TTGCCTCAGGCCTGGCTCCCTGG - Intergenic
1119426184 14:74535896-74535918 TGAGCCCAGCCCTGGCCCTGGGG + Intronic
1120709007 14:87773881-87773903 TAAGCCCAGCCCCGGATCTCAGG + Intergenic
1120875034 14:89367801-89367823 CTTGCTGAGCCCTGGCTCTCTGG - Intronic
1121243639 14:92447530-92447552 TTAGGCCAGCCCCAGCTCTCTGG + Intronic
1121279771 14:92690123-92690145 TGAGCTCTGCGCTGGTTCTCAGG - Intergenic
1121304010 14:92894207-92894229 TGACTTCAGCCCTGCCTCTCTGG + Intergenic
1121457131 14:94045635-94045657 TGAGTTCAGCTCTGGCTCTCAGG - Intronic
1121880968 14:97499954-97499976 TTGGCAGAGCCCTGGCCCTCAGG - Intergenic
1121971249 14:98358392-98358414 TATGCTCAGCCCTGGTCCTCTGG + Intergenic
1124685336 15:31777491-31777513 TTGGGTCAGCGCTGGCACTCAGG + Intronic
1125773815 15:42192518-42192540 CTAGCTCTGCCCTTGCCCTCTGG + Intronic
1129002933 15:72348979-72349001 TTAGCTCAGCTGCTGCTCTCAGG - Intronic
1129467642 15:75732857-75732879 GACGCTCAGCTCTGGCTCTCTGG + Intergenic
1132603231 16:783087-783109 TGAGCTCAGCCTTTGCTCTAGGG - Intronic
1138210602 16:55159943-55159965 TTGGTTCAGCTCTGTCTCTCTGG + Intergenic
1138585896 16:57970300-57970322 TTAGCTCAGCCCTGGCTCTCGGG - Intronic
1140745574 16:77977414-77977436 TTATCTCAGCACCGTCTCTCAGG + Intronic
1141614619 16:85203144-85203166 TGAGCTCACACCTGGCTCTGGGG + Intergenic
1141755662 16:85989096-85989118 TTAGCTCAGCCATGAGTTTCAGG - Intergenic
1142156728 16:88535709-88535731 TGTCCTCAGCCCTGGCTCTGAGG - Exonic
1142479117 17:207304-207326 GTTGCTCAGCCCTGGCGCACAGG - Intergenic
1142813473 17:2407606-2407628 GGAGCTGAGCCCTGGCTCTGTGG - Intronic
1143121213 17:4608143-4608165 TTGGCTAAGCACAGGCTCTCGGG + Exonic
1144810111 17:17993632-17993654 GAGGCTCAGGCCTGGCTCTCAGG + Intronic
1146914975 17:36672674-36672696 TTAACGCGGCCCTGCCTCTCTGG + Intergenic
1146937133 17:36818910-36818932 TGAGCTCAGCCCTGGCACCTGGG + Intergenic
1147998408 17:44374289-44374311 TTGGCTCTGCCCTGCCTCACAGG - Intronic
1149493123 17:57099409-57099431 ATTGCTCAGCCTTGGGTCTCTGG + Intronic
1150602552 17:66663376-66663398 TTAAGTCAGGCCTGGCTCCCAGG - Intronic
1152229107 17:79105863-79105885 GTGGCTCAGCCCAGGCTCCCAGG - Intronic
1153328719 18:3849619-3849641 GGAGCTCTGCCCTGGTTCTCTGG - Intronic
1153690199 18:7584866-7584888 TCAGCACAGGCCTGGCTCCCAGG - Intronic
1157496067 18:48158418-48158440 CTAGCCCAGCCCTGCCTCTATGG + Intronic
1160487235 18:79304706-79304728 TGAGCACAGCCCTGGCCCTGAGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161645520 19:5451177-5451199 CTCCCTCAGCCCTGGCTGTCTGG + Intergenic
1162353210 19:10164217-10164239 TTGGCTCACCTCTGCCTCTCAGG + Intronic
1163060254 19:14755570-14755592 TCAGCTCAGCCCTGGGGCTCAGG - Intronic
1164821109 19:31251802-31251824 TGCTCTCAGCCCTGGCTCTGTGG - Intergenic
1166631285 19:44410143-44410165 GCAGCTCACCCCCGGCTCTCTGG + Intergenic
925557529 2:5147914-5147936 CGAACTCAGCCCTTGCTCTCTGG + Intergenic
928461173 2:31474214-31474236 CTACCACAGCCCTAGCTCTCTGG + Intergenic
930260678 2:49142524-49142546 TTTGCTCACTCCTGACTCTCTGG + Intronic
933832834 2:86224547-86224569 ATACCTGTGCCCTGGCTCTCAGG - Intronic
933840556 2:86282881-86282903 TGTGCTCAGCCCTGCCTCTCAGG + Intronic
933906546 2:86899433-86899455 TTAGGTCATTCCTGGGTCTCAGG + Intergenic
934024927 2:87994213-87994235 TTAGGTCATTCCTGGGTCTCAGG - Intergenic
934976538 2:98806501-98806523 TGAGCCCGGCCCTGGCTCCCCGG - Intronic
935776002 2:106472281-106472303 TTAGGTCATTCCTGGGTCTCAGG - Intergenic
936365620 2:111852250-111852272 TTAGGTCATTCCTGGGTCTCAGG - Intronic
937453457 2:122021703-122021725 TTAGCTAAACCCAAGCTCTCTGG - Intergenic
937619932 2:123973612-123973634 CTTGCTCAGCCTTGTCTCTCAGG - Intergenic
940744271 2:157549553-157549575 TAAGCACCGCCCTGGCTATCTGG + Intronic
940754905 2:157671011-157671033 TTAGCTCATCCCTAGGTCTTTGG - Intergenic
940850427 2:158683033-158683055 TCAGTTCAGCCCTGACCCTCTGG - Intergenic
941512350 2:166427787-166427809 TCTGCTCAGCACTGGCACTCTGG - Exonic
942998556 2:182296214-182296236 TGAGCTCACCTCGGGCTCTCTGG + Intronic
944875188 2:203957146-203957168 TCATCTCTGCCCTGCCTCTCAGG - Intronic
948168195 2:235879143-235879165 GTAACTCAGTCCTGGCTTTCAGG + Intronic
948309641 2:236975429-236975451 TAAGCACAGCCCTGGACCTCAGG + Intergenic
948604078 2:239123657-239123679 TCAGCTCAGCCCTGGCGCAGTGG - Intronic
948901703 2:240959640-240959662 TAAGCCAAGCCCAGGCTCTCAGG + Intronic
1170561045 20:17558806-17558828 TCAGCCCAGACCTGGCCCTCTGG - Intronic
1170767398 20:19301990-19302012 TTAGCCTAGCCCTGGCTCCAAGG - Intronic
1170935273 20:20804494-20804516 TTTGCTGAGGCCTGGCTGTCAGG + Intergenic
1171326878 20:24302574-24302596 TAACCTCAGCCCTAGCTCCCAGG + Intergenic
1171869772 20:30515453-30515475 GTAGCTCACCCCTGGCTCTCAGG - Intergenic
1171870558 20:30521231-30521253 GTAGCTCACCCCTGGCTCTCGGG - Intergenic
1173230543 20:41192682-41192704 ACACCTCAGCCCTGGCACTCAGG + Intronic
1174445282 20:50586934-50586956 TTGGCTCAGCTCTGCATCTCGGG + Exonic
1174911440 20:54612265-54612287 TTACGTCAGCACTGGCTCACGGG - Intronic
1175257860 20:57657775-57657797 TTGGCTCAGCCCAGGGACTCTGG + Intronic
1176955690 21:15100520-15100542 TGAACCCAGGCCTGGCTCTCAGG + Intergenic
1178258300 21:31075420-31075442 TTAGCTAAGACCAGGCTCACAGG - Intergenic
1179768803 21:43597215-43597237 ATACCTGAGCTCTGGCTCTCTGG - Intronic
1181580376 22:23824844-23824866 TTAGCTGAGCCCTGCCTTTCTGG + Intronic
1181978470 22:26749380-26749402 TTGGCTCAGACCTGGTTCACTGG - Intergenic
1182361420 22:29748643-29748665 TGGGCTCAGGCCTGGCCCTCAGG - Intronic
1184468487 22:44682621-44682643 TTAGCTCAGGCCTGGCCCATAGG + Intronic
1184496145 22:44842730-44842752 GATGCTCAGCCCTGGCTCTGAGG - Intronic
1185082879 22:48719316-48719338 GCAGCTCAGCCCTGGCTGCCTGG + Intronic
949575629 3:5336518-5336540 TTAGCAGAGTTCTGGCTCTCAGG - Intergenic
950436681 3:12984386-12984408 TTAGCTCAGCCCTGGGCCTGTGG - Intronic
952130363 3:30354810-30354832 GGAGCTCAGCCCAGGCTCCCAGG + Intergenic
953822360 3:46218650-46218672 TTAAATCAGCCCTGCCTCCCTGG - Intronic
954266026 3:49470690-49470712 TTAGCTCGGCCCGCGCTCCCGGG + Intronic
954391581 3:50270543-50270565 TTAGCCCTGCCCTGTCTCTGGGG - Intronic
954637217 3:52077545-52077567 TCAGCTCAGCTCTGCCTCTTAGG - Intronic
954682396 3:52352834-52352856 ATAGCCCAACCCTGGCCCTCAGG + Intronic
956723951 3:72141775-72141797 CTAGCTCAGCCCTCTTTCTCTGG - Intergenic
960096600 3:113696232-113696254 TTAGCGCAGCCCTGGCCTCCCGG + Intronic
960915157 3:122687376-122687398 TCAGCTCATCCCCAGCTCTCTGG - Intronic
961500161 3:127326702-127326724 TTAGTTCATCCCTAGTTCTCAGG + Intergenic
961862414 3:129927351-129927373 TGATCACAGCCCTGGCTCCCTGG - Intergenic
962267764 3:133955616-133955638 TGTGCTCAGCCCTGGGGCTCTGG + Intronic
962286845 3:134093486-134093508 TCAGCTCAGCACTGCCTCTCAGG - Intronic
963345580 3:144093171-144093193 TTAACTCTTCCCTGGGTCTCAGG + Intergenic
967149767 3:186637784-186637806 TTAGCACAGCCCTGGTGCACAGG - Intronic
968893154 4:3383126-3383148 CCAGCTCAGCCATGGCCCTCGGG - Intronic
968961179 4:3744472-3744494 GTGGGTCAGCCCTGGCTCCCCGG - Intergenic
971419519 4:26462665-26462687 CTAGCTCAGGCCAGGCTGTCAGG + Intergenic
974346438 4:60688136-60688158 TTACCTCAGGCCAGGCTGTCTGG + Intergenic
981359354 4:143829363-143829385 TTAGCACAGCCCTGGAGCTCCGG + Intergenic
981370125 4:143950319-143950341 TTAGCACAGCCCTGGAGGTCCGG + Intergenic
981379888 4:144060374-144060396 TTAGCACAGCCCTGGAGGTCCGG + Intergenic
982123453 4:152163617-152163639 TTAGCTCAGCCCTGGATGGATGG + Intergenic
983575807 4:169260521-169260543 CCACCTCTGCCCTGGCTCTCTGG - Intronic
984803329 4:183733939-183733961 TTATCTTAGCCCAGGTTCTCTGG - Intergenic
985114551 4:186577809-186577831 TGAGCTCAGGCCTGGCTCAGTGG - Intergenic
986204900 5:5614218-5614240 TTACCTCAGAACTGGCTCCCTGG + Intergenic
990951409 5:61302148-61302170 TGAGCTGAGCCCTGGCTCTTGGG - Intergenic
991564029 5:67985923-67985945 TCGGCTCAGCCCTGACCCTCTGG + Intergenic
994000175 5:94770287-94770309 GTGTGTCAGCCCTGGCTCTCGGG - Intronic
999748370 5:154608886-154608908 TGATCTCAGCCCTGGCTGTGGGG + Intergenic
1001247020 5:170112392-170112414 TTAGCACAGACATGGCTCTTAGG + Intergenic
1001313629 5:170627968-170627990 TTAGCTCAGGCCTGGCGCTGGGG - Intronic
1001426068 5:171623559-171623581 CCCGCTCAGCCCTGGCTCTCAGG + Intergenic
1002060063 5:176620733-176620755 TAAGGACAGCCCTGGCTCTGGGG + Exonic
1002471675 5:179439313-179439335 CTGGCTCAGCCCTGGCTCTTGGG - Intergenic
1002838809 6:888049-888071 CACGCTCAGGCCTGGCTCTCAGG + Intergenic
1005897701 6:30192049-30192071 CCAGCCCTGCCCTGGCTCTCGGG - Intronic
1006381401 6:33699863-33699885 CTACTTCATCCCTGGCTCTCCGG + Intronic
1007421042 6:41719996-41720018 TTAGCACAGCGCTGGCACACAGG + Intronic
1007810878 6:44484963-44484985 CTGGTGCAGCCCTGGCTCTCGGG - Intergenic
1013581295 6:111537042-111537064 TTCCCTCAGCTCTGGCACTCTGG - Intergenic
1018904761 6:168069221-168069243 TTTGCTAACCCCTGGCTCTGAGG - Intronic
1020092198 7:5348080-5348102 GGAGCCCAGCCCAGGCTCTCAGG + Intronic
1020481576 7:8668846-8668868 CTAGCACTGCCCTGGCACTCAGG + Intronic
1023976771 7:45036367-45036389 AAAGCTCAGCCTTGGCTGTCAGG + Intronic
1024425238 7:49217199-49217221 TTAGCTCAGCACAGGCTGTGAGG - Intergenic
1026930340 7:74220103-74220125 ATAGCTGAGCCCTGGAGCTCTGG - Intronic
1032090977 7:128911449-128911471 TGAGCTCAGGCCTGGCTGTGGGG + Intergenic
1032695521 7:134332698-134332720 ATAGCTCAACCCTGGCTATATGG - Intergenic
1036638122 8:10565251-10565273 TTAGCTCGGTCCAGGCTCCCTGG - Intergenic
1037893833 8:22638630-22638652 TCTGCTTAGCTCTGGCTCTCTGG + Intronic
1038268213 8:26052115-26052137 GGAGCTCGGCTCTGGCTCTCGGG - Intergenic
1038406379 8:27325692-27325714 AGCGCTCAGCCCTGGCTCGCGGG - Intronic
1038707254 8:29906181-29906203 TTAACTCTTCCCTGGGTCTCCGG - Intergenic
1040548653 8:48421796-48421818 TGAGCTCAGCACTGGCTGGCTGG - Intergenic
1041715252 8:60926414-60926436 TTAGGTCAGCCCTAGCTTGCTGG + Intergenic
1044738664 8:95303926-95303948 TTTCCTCAGCGCAGGCTCTCTGG + Intergenic
1045872045 8:106938217-106938239 TTAGCTTAAGCCTGGTTCTCTGG + Intergenic
1047286667 8:123493101-123493123 TGAGCTTAGCCCTTGCCCTCAGG - Intergenic
1047738024 8:127783687-127783709 TAAGCTCTGTGCTGGCTCTCAGG + Intergenic
1051073939 9:13207492-13207514 TTACCTCAGCCTGGACTCTCTGG + Intronic
1052970088 9:34372101-34372123 GTAGCTCAGCTCTGGCGCTGCGG + Exonic
1054993839 9:71361997-71362019 CTAGCTGAGCCTTGGTTCTCTGG - Intronic
1056350093 9:85741432-85741454 TCTGCTCAGCCCTTTCTCTCGGG - Intronic
1058398180 9:104580441-104580463 CTAGTTCAGCCCTGGCTATTGGG + Intergenic
1060400886 9:123349059-123349081 TTAGCTCTGCCACGGTTCTCTGG + Intergenic
1061667852 9:132170679-132170701 TCAGCTCACCCCTGAGTCTCGGG - Intronic
1061680439 9:132240364-132240386 GCAGCTCAGTGCTGGCTCTCGGG - Intronic
1062003669 9:134228956-134228978 CAAGCACACCCCTGGCTCTCTGG + Intergenic
1062021609 9:134322151-134322173 TGACCTCAGCCCTGGGTCTGGGG + Intronic
1062102076 9:134733628-134733650 TGAGCCCAGGCCTGGCTCTGAGG - Intronic
1062126250 9:134864562-134864584 TCGGCTCAGCCCTGGGGCTCTGG - Intergenic
1062271557 9:135712185-135712207 TCACCTCAGCCCTGGCTCCAAGG + Intronic
1062526548 9:136980190-136980212 TTAACTCAGCCCTGGGGGTCTGG - Exonic
1188008383 X:25034142-25034164 GTAGCTCATGCCTGGCTCTTAGG + Intergenic
1189653226 X:43211943-43211965 TGAGCTGAGACTTGGCTCTCTGG + Intergenic
1191851161 X:65587516-65587538 TCAGCTCAGCCCTGGCTCTGAGG + Intergenic
1196185806 X:112743738-112743760 CTATTTCAGCCCAGGCTCTCAGG + Intergenic
1199654264 X:149979284-149979306 TTTGCCCAGCCCTGACGCTCTGG - Intergenic