ID: 1138589718

View in Genome Browser
Species Human (GRCh38)
Location 16:57993231-57993253
Sequence CACCAGGCCTGCTTCAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138589710_1138589718 13 Left 1138589710 16:57993195-57993217 CCATGGGTTGATCCTGGCGCCTT No data
Right 1138589718 16:57993231-57993253 CACCAGGCCTGCTTCAGATGGGG No data
1138589712_1138589718 -6 Left 1138589712 16:57993214-57993236 CCTTCCCAGAATCAGAGCACCAG No data
Right 1138589718 16:57993231-57993253 CACCAGGCCTGCTTCAGATGGGG No data
1138589711_1138589718 1 Left 1138589711 16:57993207-57993229 CCTGGCGCCTTCCCAGAATCAGA No data
Right 1138589718 16:57993231-57993253 CACCAGGCCTGCTTCAGATGGGG No data
1138589714_1138589718 -10 Left 1138589714 16:57993218-57993240 CCCAGAATCAGAGCACCAGGCCT No data
Right 1138589718 16:57993231-57993253 CACCAGGCCTGCTTCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138589718 Original CRISPR CACCAGGCCTGCTTCAGATG GGG Intergenic
No off target data available for this crispr