ID: 1138590259

View in Genome Browser
Species Human (GRCh38)
Location 16:57995859-57995881
Sequence CAGTGGGCCCAGGGGGAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 1, 2: 2, 3: 68, 4: 634}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138590259 Original CRISPR CAGTGGGCCCAGGGGGAAGG GGG (reversed) Exonic
900126665 1:1071829-1071851 CAGAGGCCCGAGGGGGGAGGCGG + Exonic
900179862 1:1306328-1306350 CGGAGGGGCCAGGGAGAAGGTGG + Intronic
900336360 1:2165936-2165958 CAGTGGCCGCAGGGGGATGCTGG - Intronic
900457777 1:2785785-2785807 GACTGGGCCCTGGGGGCAGGTGG + Intronic
900623692 1:3598720-3598742 GAGTGGGCCCCGGGGGGGGGGGG - Intronic
900642775 1:3695309-3695331 CAGCGGCCCCAGGAGGAAGTGGG - Intronic
900704843 1:4073962-4073984 CTGTGAGCCCTGAGGGAAGGGGG + Intergenic
900800881 1:4736324-4736346 CAGGAGGCCAAGGGAGAAGGCGG - Intronic
900963562 1:5941854-5941876 CAGGGGGCCCTGGGGACAGGAGG + Intronic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901239748 1:7686077-7686099 CAGGCAGCCCAGGTGGAAGGAGG - Intronic
901493240 1:9607307-9607329 CTGTGAGCCGAGGGGGTAGGAGG + Intronic
901679797 1:10906397-10906419 CAGTGGGCTCAGGGAGAGGAAGG - Intergenic
901685560 1:10941716-10941738 TAGTGGTCACTGGGGGAAGGGGG - Intergenic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
901829794 1:11885480-11885502 CAGTGGGACCTGGGGTAGGGAGG + Intergenic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902717298 1:18281624-18281646 GAGTGGGCTGAGGAGGAAGGAGG - Intronic
902801079 1:18830655-18830677 TCGTCGGCCCAGGGGGAAGAAGG + Intergenic
902943464 1:19816611-19816633 TAGAGGGCCCAGGGGGAGTGGGG - Intergenic
903291563 1:22317483-22317505 CAAAGGGGCCAGGAGGAAGGGGG + Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
904988730 1:34574018-34574040 CAGTGGGTGCCAGGGGAAGGGGG + Intergenic
905001183 1:34671327-34671349 CTGTGGGGCCAGGGGGTTGGGGG - Intergenic
905009731 1:34739247-34739269 CAGCAGGCCCAGAGGAAAGGCGG - Intronic
905226382 1:36481835-36481857 CAGGGGGCCCAGGAGTTAGGAGG - Intronic
905286445 1:36883559-36883581 AAGTGGGCTCAGGGGCAAGTGGG + Intronic
905552579 1:38855191-38855213 CAGTCAGTCCAGGGGGGAGGTGG + Intronic
906913461 1:49982394-49982416 CAGGGGGCCAAGGTGGCAGGGGG - Intronic
906969390 1:50495241-50495263 CAGTGGGGTGTGGGGGAAGGTGG - Intronic
907051310 1:51331215-51331237 GAGGGGGCCAAGGGGGAAAGGGG - Intronic
907414272 1:54303370-54303392 CAGTCAGCCCAGGGGGCAGGGGG + Intronic
907566291 1:55437362-55437384 CAGTGGTTCCATGGGGTAGGAGG + Intergenic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
910257100 1:85259291-85259313 CAGGGGGCTCAGGAGAAAGGGGG + Intronic
910952650 1:92667177-92667199 CAGGAGGCTCAGGGGGAAGACGG + Intronic
911032168 1:93500684-93500706 TAGTGGTCCCAGAAGGAAGGGGG + Intronic
912005597 1:104896110-104896132 CAGTGGGAAAAGGGGGAATGGGG + Intergenic
912390656 1:109300382-109300404 GAGGAGGCCCAGAGGGAAGGCGG + Intronic
912417579 1:109520496-109520518 CAGTGGGGCCAAGGGGTAGCTGG + Intergenic
913220244 1:116654332-116654354 CAGAGGGCTCACGGAGAAGGGGG + Intronic
914850486 1:151310268-151310290 CAGAGGGCAAAGGGAGAAGGAGG + Intronic
915400624 1:155619189-155619211 CAGTGGCCCAAGGTGGATGGAGG - Intergenic
915418149 1:155758195-155758217 CAGTGGCCCAAGGTGGATGGAGG - Intronic
915724371 1:158007329-158007351 ACCTGGGCCCAGGTGGAAGGAGG + Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917791209 1:178500186-178500208 CAGAGGGCCGATGGTGAAGGCGG + Intergenic
917929169 1:179812187-179812209 CATTGGGACCAAGGGGCAGGAGG - Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
919293192 1:195660392-195660414 AAGTGGGCCCATGGGCAGGGTGG - Intergenic
919850247 1:201667586-201667608 CAGTGGACCCGGGGAGGAGGAGG + Intronic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920349490 1:205328541-205328563 AAGTGTGCCCAGGAGGGAGGTGG + Intergenic
920387650 1:205580028-205580050 AAGTGGGCCCCTGGGGGAGGAGG - Intronic
920904684 1:210151076-210151098 CAGAAGACTCAGGGGGAAGGAGG + Intronic
921098595 1:211909163-211909185 CAGAGGGCCCAGAGCAAAGGTGG + Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
922188437 1:223296370-223296392 GAGTGGGCCTAGGGAGAAGGGGG + Intronic
922459320 1:225802842-225802864 CAGTGGCCTCAGGTGGAATGGGG + Intergenic
922480618 1:225938093-225938115 CAGTGGCCTCAGGTGGAATGGGG - Intronic
923232240 1:231997767-231997789 CAGTGGGTTCAGGTGGTAGGAGG - Intronic
924045960 1:240030826-240030848 GATTGAGCCCAGGGGGAAGGAGG + Intronic
924709115 1:246519525-246519547 CTGTGGGCCTAGGGGAATGGGGG - Intergenic
924931675 1:248737814-248737836 CAGTGGGTCATGGGGGATGGTGG + Intronic
1066080622 10:31928132-31928154 GAGTGGGCCCAGGGCGCGGGAGG + Intronic
1066285860 10:33965554-33965576 CAGGAGGCCAAGGGGCAAGGAGG - Intergenic
1068134193 10:52935560-52935582 AGGTGGGCACAGGGGTAAGGTGG - Intergenic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069440453 10:68423782-68423804 AAGTGGGCCCAGCGGTAACGAGG + Intronic
1069532730 10:69230985-69231007 CAGTGGACCCTGGGAGAGGGAGG - Intronic
1069574678 10:69517873-69517895 AACTGGGCCCATGGGAAAGGGGG + Intergenic
1069628009 10:69880296-69880318 CAGAGGGCACAGGGGCAAGGAGG - Intronic
1070058781 10:72960882-72960904 TAGTGGGCATAGGGGGAAGTGGG - Intergenic
1070238690 10:74656255-74656277 CTGTGGGCCCTGGGGGAAACTGG - Intronic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070495226 10:77015337-77015359 CTGTGGGGTCAAGGGGAAGGAGG - Intronic
1070602070 10:77872970-77872992 CAGAGTGCCCAGGGCTAAGGGGG + Intronic
1070798344 10:79230244-79230266 CAGTGGTCCCAAGGGGAAAGGGG - Intronic
1071470658 10:85981876-85981898 GAGAGGGACCAGGGAGAAGGAGG + Intronic
1071524053 10:86347963-86347985 CACTGGGACCATGGGGAAGGTGG - Intronic
1071589864 10:86862543-86862565 TAGTGGGCACAGGTGGAAGCAGG + Intronic
1071598011 10:86942168-86942190 CAGGTGGGCCAAGGGGAAGGTGG + Intronic
1071689174 10:87797425-87797447 CAGATGGCAAAGGGGGAAGGAGG - Intronic
1071897236 10:90080958-90080980 CAGATGGCAAAGGGGGAAGGAGG - Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072394475 10:95024685-95024707 GAGTGGGGGGAGGGGGAAGGGGG + Intergenic
1073056218 10:100704422-100704444 CAGAGGGGCCAGGGTGATGGTGG - Intergenic
1073116563 10:101094808-101094830 AAGTGGGCACAGGTGGAAGGAGG - Intronic
1073473823 10:103740057-103740079 TAGTGGGCAGAGGAGGAAGGAGG + Intronic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076438390 10:130462290-130462312 CACGGGACCCATGGGGAAGGGGG + Intergenic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076853560 10:133104607-133104629 AAGGGGGCCCAGAGGGCAGGGGG - Intronic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1077021869 11:420560-420582 CAGCGGCGCCAGCGGGAAGGCGG + Exonic
1077132118 11:978249-978271 CAGAAGGCCCAGGGGAAAGCAGG - Intronic
1077281818 11:1749385-1749407 CAGTGGGTCCGGGGAGATGGAGG - Intronic
1077364896 11:2157666-2157688 CATTGGGCCTGGGGGGATGGAGG + Intronic
1077391851 11:2303944-2303966 CAGACGGCCCTGAGGGAAGGAGG - Intronic
1077597162 11:3543777-3543799 TTGGGGGCTCAGGGGGAAGGTGG - Intergenic
1081679245 11:44990174-44990196 CAGCGATCCCATGGGGAAGGCGG + Intergenic
1081701405 11:45155085-45155107 GAGTGGGCCCAGCAGGCAGGAGG + Intronic
1081758575 11:45561359-45561381 AATTGGGCCCAGGGAGATGGCGG + Intergenic
1083171304 11:60925194-60925216 CAGGGAGCCCTGGGGGAAGGGGG - Intronic
1083396904 11:62398648-62398670 GAGTGGGCCCAGGGGAGGGGCGG - Intergenic
1083615401 11:64023674-64023696 GAATGGGCCCAGTGGGAAGGAGG - Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1083897085 11:65625349-65625371 GACTGGGGCCGGGGGGAAGGAGG + Intronic
1083964481 11:66035025-66035047 CAGGTGGCACAAGGGGAAGGGGG + Intergenic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1084096112 11:66912710-66912732 GAGTGGGCCAAGAGGGAATGGGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084171585 11:67403781-67403803 CACTGGGGCCATGGGGAAGGTGG + Intronic
1084253092 11:67917748-67917770 TTGGGGGCTCAGGGGGAAGGTGG - Intergenic
1084446316 11:69205622-69205644 CCTTGGGCCCATGGGGAGGGAGG - Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085295626 11:75430120-75430142 CAGCGGGGCCAGCGAGAAGGCGG + Exonic
1085317639 11:75555137-75555159 CAGTGAGCTCTGGGGGAAGCTGG - Intergenic
1085638670 11:78177521-78177543 CAGAGGGCCCAGGCAGGAGGTGG + Intronic
1085724615 11:78943209-78943231 CAGGAGGCCCTGGAGGAAGGGGG + Intronic
1085739272 11:79065081-79065103 CAGTGAGCCCTGGGGTAAGAAGG - Intronic
1087781569 11:102306364-102306386 CAGTGTGCCCTGGGGAAAGGGGG + Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1088906319 11:114157887-114157909 CAGTGGAGCCAGGGGCAGGGTGG - Intronic
1089058942 11:115610246-115610268 CACTGGGGCCTGTGGGAAGGGGG - Intergenic
1089308426 11:117541792-117541814 GGCAGGGCCCAGGGGGAAGGTGG + Intronic
1089510973 11:118997014-118997036 CTATAGGCCCAGGGGGAATGGGG + Intergenic
1089614364 11:119686923-119686945 CAGGGGGCCCAAGTGGCAGGTGG + Intronic
1090271611 11:125389907-125389929 GAGTGGGCCCAGGGGCCTGGGGG - Intronic
1090386374 11:126359756-126359778 GGGAGGGCCCACGGGGAAGGAGG - Intronic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091553348 12:1553630-1553652 CTGTGGCCCCAGGAGGAAGCTGG + Intronic
1091569294 12:1670447-1670469 CTGAGTGCCCAGGGAGAAGGAGG - Intergenic
1091816927 12:3445915-3445937 CAATGGGGCCAGGAGGTAGGTGG - Intronic
1091950318 12:4587349-4587371 CAATCGGCCCAGGAGGATGGTGG - Intronic
1092433961 12:8431510-8431532 CAGTGAGCCCAGGGGACCGGCGG + Intergenic
1094176896 12:27550191-27550213 CAGTGGCCCCATGGGGGAGCTGG + Intronic
1094350840 12:29523012-29523034 CAGTGGGCCAATGGGGAATTGGG + Intronic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1096113923 12:49044158-49044180 CAGTGGGGCCTGGGAGAAGGTGG - Intronic
1096148844 12:49296310-49296332 CGGTGGGCGCGGGGAGAAGGGGG + Intronic
1096549479 12:52362762-52362784 CAGTGTGCCCATGAGGAAGCAGG - Intronic
1097190313 12:57216548-57216570 CTGTGCGCCCAGGAGGAACGGGG - Intergenic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1100268784 12:93003737-93003759 CAGTGAGCACAGGGAGGAGGAGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1102077263 12:110069527-110069549 CAGTGGACCCACTGGGAAGAAGG - Intronic
1102520199 12:113472984-113473006 CGCTGGCCCCAGGGGAAAGGAGG - Intergenic
1102640434 12:114361949-114361971 CTGTGGGCTCAGGGTGAATGGGG - Intronic
1103089467 12:118087358-118087380 CAGAGGACCAAGGGGTAAGGAGG + Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103320672 12:120091079-120091101 CAGTGGGCCATGAGGGGAGGCGG - Intronic
1103516781 12:121513440-121513462 CAGAGGGCGAAGGGGGAAGGAGG + Intronic
1103890138 12:124232354-124232376 CAGGGGCCCCAGGTGGGAGGTGG - Intronic
1104039379 12:125119873-125119895 CAATGGGCTCAGGAGAAAGGTGG - Intronic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1105705647 13:22966103-22966125 CAGGAGGCCCAGGGGCCAGGAGG + Intergenic
1105858550 13:24391088-24391110 CAGGAGGCCCAGGGGCCAGGAGG + Intergenic
1106097405 13:26660332-26660354 CAGAGGGCCCACGAGGCAGGAGG + Intronic
1107333019 13:39321816-39321838 GAGTGGGCCCAGAGGGAATGAGG - Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1109293070 13:60498929-60498951 CAGTGGGTCCAGTGGGTACGCGG + Intronic
1110257157 13:73444972-73444994 CAGTTTGCCCAGGGAGAGGGAGG - Intergenic
1112004341 13:95241514-95241536 CAGGGGGGGCAGGAGGAAGGAGG - Intronic
1112549243 13:100404231-100404253 CAGTTTGCACAGGGAGAAGGAGG + Intronic
1113066999 13:106382772-106382794 AAGTGAGCCCAGGGGTAAGACGG + Intergenic
1113126107 13:106981481-106981503 CAGTGGGCTCAGGGGGAGAGGGG - Intergenic
1113295239 13:108952355-108952377 CACTGGGCTCAGGGGCAAGACGG + Intronic
1113488795 13:110676310-110676332 CAAGGGGACCAGGGAGAAGGCGG + Intronic
1113569244 13:111342157-111342179 GAGTGGGCTCATGGTGAAGGTGG - Intronic
1113727779 13:112618046-112618068 CACTGGGCCCTGGAGGGAGGGGG - Intergenic
1113962266 13:114132619-114132641 CAGTTGGCCGAGGGCGAGGGCGG + Intergenic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1117438689 14:55741132-55741154 CAGTGTGCCCTGGGAGATGGGGG + Intergenic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120056642 14:79932055-79932077 TAGTGGGCTCAGAGGGCAGGGGG - Intergenic
1122015336 14:98790269-98790291 CAGTGGGACCAGGTGGGAGCAGG - Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122205510 14:100146067-100146089 GTGTGGGCTCAGGGGGATGGGGG + Exonic
1122374926 14:101251265-101251287 CTCAGGGCCCAGGGGGAGGGTGG + Intergenic
1122412135 14:101531040-101531062 CAGAGGGACCAGGGGCAGGGCGG - Intergenic
1124052213 15:26207961-26207983 AAGTGAGCCCATAGGGAAGGAGG + Intergenic
1125160870 15:36642034-36642056 CAGTGGGCGCAGGGTAGAGGTGG + Intronic
1127054104 15:55114060-55114082 CCATGGGCCCAGAAGGAAGGGGG + Intergenic
1127365340 15:58284279-58284301 CCTTGGGCACAGGGAGAAGGAGG + Intronic
1128138604 15:65282814-65282836 AAGTGGGGCAAGGGAGAAGGGGG + Intronic
1129117904 15:73375464-73375486 TAGAGGGCCGAGGGGGGAGGAGG + Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129661748 15:77556609-77556631 AACTGGGCCCAGGTGGAAGGTGG - Intergenic
1129691838 15:77718156-77718178 CCGTGGGCCCTGGAAGAAGGTGG - Intronic
1129734181 15:77950735-77950757 CAGTGGTCCCTTTGGGAAGGTGG - Intergenic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1129841402 15:78745256-78745278 CAGTGGTCCCTTTGGGAAGGTGG + Intergenic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129869052 15:78929238-78929260 CAGTGGGCTCAGGTGGGTGGAGG + Intronic
1130220507 15:82015392-82015414 CAGTGGGACCAGCCTGAAGGAGG - Intergenic
1130742448 15:86615392-86615414 CAGTGGGATCTGGGGTAAGGAGG + Intronic
1130849256 15:87777820-87777842 TAGTGCGCCTCGGGGGAAGGAGG + Intergenic
1131034255 15:89210829-89210851 CACTGGGGCCATGGGGAACGGGG - Intronic
1131157412 15:90083807-90083829 CAGTGGGCCCCTGTGGAATGCGG + Exonic
1131271019 15:90947753-90947775 CAGTTGGCCTCTGGGGAAGGAGG - Intronic
1132012421 15:98287770-98287792 CAGAGGGCCCCGTGGAAAGGAGG - Intergenic
1132028311 15:98421057-98421079 CATTGGCTCCAGGGGCAAGGAGG - Intergenic
1132548704 16:545360-545382 CGGTGGGCCGAGGTGGAAGGGGG - Intronic
1132606237 16:794922-794944 CACTGGGCCCAAGGGGTCGGGGG - Intronic
1132644034 16:990687-990709 CCGTAGGCCCATGGGGAAGGCGG - Intergenic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132743279 16:1426511-1426533 CAGTGGGCTGAGTGGGACGGGGG - Intergenic
1132840194 16:1975104-1975126 CAGTGGGCCCTGGTAGGAGGGGG + Intronic
1134024630 16:10944573-10944595 CTGTGGGCCGGGGAGGAAGGCGG + Exonic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134103474 16:11469309-11469331 CAGTCCTCCCAGGGGGACGGAGG - Intronic
1134219903 16:12345721-12345743 ATGTGGGCACAGTGGGAAGGTGG + Intronic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1136395985 16:29992777-29992799 CAGAGGGGCCACGGGGTAGGCGG + Exonic
1137286205 16:47017782-47017804 CAGATGGCCCAGGTGGGAGGCGG + Intergenic
1137613617 16:49834857-49834879 AAGTGGGTCAAGGAGGAAGGAGG + Intronic
1137697395 16:50470208-50470230 CAGTGGGCGGATGGGGGAGGGGG + Intergenic
1137719086 16:50617183-50617205 CATTGGGCCCATGGGGAGGCGGG + Intronic
1138345008 16:56315399-56315421 CACTGGGCTCAGGGGAAAGGAGG + Intronic
1138390660 16:56668040-56668062 CAGTGGGTGCACGTGGAAGGCGG + Exonic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139357769 16:66377456-66377478 CAGTGGGCCCAGAGGTCAGCTGG + Intronic
1140209384 16:72958877-72958899 CAGAGGCCCCAGGGGGACTGAGG + Exonic
1140412413 16:74748943-74748965 ATGGAGGCCCAGGGGGAAGGTGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140454201 16:75095294-75095316 CAGTCAGCCCAGGAGAAAGGAGG - Intronic
1140504082 16:75459441-75459463 GAGTGGGGCCAGCTGGAAGGAGG - Intronic
1140511517 16:75512243-75512265 AAGTGGGGCCAGCTGGAAGGAGG - Intergenic
1140832239 16:78762589-78762611 CAGTGGGCACAGGGGGCTCGGGG + Intronic
1141203487 16:81914836-81914858 CAGTGGGCCATGGGGTGAGGTGG - Intronic
1141331748 16:83117362-83117384 GAATGGGCCAAGGGGGCAGGAGG - Intronic
1141336800 16:83163545-83163567 CTGTGTGCCCAGGAGGAACGGGG - Intronic
1141670520 16:85489358-85489380 CAGTGGGCACTGGGGGCTGGGGG + Intergenic
1142135926 16:88452088-88452110 CAGTGGGCCCAGGGGCAGACAGG - Intergenic
1142279428 16:89140069-89140091 CTGTGGGCCAAGGGTGAAAGAGG - Intronic
1142387341 16:89774305-89774327 AAGTGGACCCCAGGGGAAGGAGG + Intronic
1142428203 16:90011783-90011805 CAGAGGGCACAGGGGACAGGGGG + Intronic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1142950946 17:3479625-3479647 GAGTCGGTGCAGGGGGAAGGTGG - Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143109137 17:4543789-4543811 CAGAGGGCCCAGGAGGGAGGCGG - Intronic
1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143214822 17:5216951-5216973 CAGTGTACCTAGGGGGATGGAGG - Intronic
1143321731 17:6072725-6072747 CAGGAGGCCCAGGGAGAAGGTGG - Intronic
1143499489 17:7330442-7330464 CAGTGGGGCCATGGAGAAGGTGG + Intergenic
1143712623 17:8744887-8744909 CAATGGGGGCAGGGGGCAGGGGG - Intronic
1143755106 17:9061326-9061348 CAGTGGCCCAAAGGGTAAGGGGG + Intronic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1144493130 17:15731592-15731614 CAGTGGGGTCAGTGGGAACGTGG + Intergenic
1144703329 17:17352310-17352332 CAGCGGGCTCAGGGGGTGGGTGG + Intergenic
1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1144907125 17:18645060-18645082 CAGTGGGGTCAGTGGGAACGTGG - Intronic
1145156936 17:20550171-20550193 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145212033 17:21020965-21020987 CTGTGGGCCTTAGGGGAAGGTGG + Intronic
1145273631 17:21417633-21417655 CTGTGGGCCCAGTGGGGACGGGG - Exonic
1145311826 17:21705075-21705097 CTGTGGGCCCAGTGGGGACGGGG - Intergenic
1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145799100 17:27672043-27672065 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1146268080 17:31466220-31466242 CAGTGGGTCCCAGGGGAAGGAGG + Intronic
1146368619 17:32249687-32249709 AGGTGGGCAAAGGGGGAAGGAGG - Intronic
1146524300 17:33552960-33552982 CAGTGGGCCCAGGGTTCAGTTGG - Intronic
1146629172 17:34457913-34457935 CCTTAGGCCCAGGGGGAAAGGGG - Intergenic
1148685924 17:49501219-49501241 CAGTGGCCACATGGGGGAGGGGG + Intronic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1151553585 17:74835655-74835677 CAGTGGGGCCAGTGGCAGGGTGG - Intronic
1151642348 17:75405404-75405426 GAGTGGGCCCCGGGGGAACCGGG - Exonic
1151678971 17:75614115-75614137 GGGTGGGCCAAGGGGGCAGGGGG - Intergenic
1151871202 17:76838132-76838154 CCGTGTGCTCAGGGCGAAGGTGG - Intergenic
1152025133 17:77804041-77804063 TAGTGAGCCCAGTGGGAAGCAGG + Intergenic
1152067404 17:78119202-78119224 CTGTGGCCCCAGGGGGAGGCAGG + Intronic
1152324169 17:79625981-79626003 CAGTTGCTCCAGGGGAAAGGCGG + Intergenic
1152433282 17:80260952-80260974 CAGTGGGCCCCGCGGGCCGGCGG + Intronic
1152793836 17:82296972-82296994 CATGGGGCGCTGGGGGAAGGCGG - Intergenic
1152805516 17:82354025-82354047 GAGTGGTCCCATGGGGAAAGGGG - Intergenic
1153439839 18:5104195-5104217 CTTTGGGCGCTGGGGGAAGGGGG - Intergenic
1153550757 18:6259062-6259084 CAGAGTGCCCGGGGGGAAGCAGG + Intronic
1153813519 18:8773234-8773256 CAGGGGGTGCAGGGGGATGGTGG - Intronic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1155339458 18:24799287-24799309 TAGTGGGCCCAGGAGGCAGCAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156498382 18:37540938-37540960 GAGTGGGGGCATGGGGAAGGAGG + Intronic
1157442394 18:47720900-47720922 AGGTGAGCCCAGGGAGAAGGAGG + Intergenic
1157793697 18:50556741-50556763 CACTGGGCCCAGGCAGAAAGAGG + Intergenic
1159955197 18:74514007-74514029 CCCTGGGCCCAGCGGTAAGGAGG - Intronic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160209734 18:76866814-76866836 CAGGGCGCGCAGGGGGAGGGAGG + Intronic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160511723 18:79456694-79456716 GAGCGGGCCGAGGAGGAAGGTGG + Intronic
1160913930 19:1487853-1487875 CAGGGGGTCCTGGGGGCAGGTGG + Exonic
1161069553 19:2253313-2253335 GAGAGGGCGCAGGGGAAAGGCGG + Intronic
1161123599 19:2543818-2543840 GAGTCAGCCCCGGGGGAAGGTGG + Intronic
1161310260 19:3589970-3589992 CAGGGGTCCCAGCGGGAAGTTGG + Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1161391631 19:4024164-4024186 CAGTGAGCCCAGGAGAAAGTGGG - Intronic
1161569130 19:5020607-5020629 CCGCGGGCGCTGGGGGAAGGGGG + Intronic
1161659795 19:5539219-5539241 CGGTGGGCTCACAGGGAAGGTGG + Intergenic
1161707180 19:5827694-5827716 CAGTGGGTGCAGGGGGTGGGAGG - Intronic
1162531515 19:11238771-11238793 GAGTTGCCCCTGGGGGAAGGAGG - Intronic
1162600602 19:11665464-11665486 CAGTGGGCACAAGAGGATGGGGG + Intergenic
1162743468 19:12786347-12786369 CAGTGGGGCCAGCAGGGAGGGGG + Intronic
1163442175 19:17327797-17327819 CAGCGCCGCCAGGGGGAAGGCGG + Exonic
1163633363 19:18427875-18427897 CTGTGGGCCAAAGGGGAAGATGG - Intronic
1163678179 19:18665897-18665919 CATTGAGCCCATGGGGCAGGCGG - Intronic
1163770695 19:19189335-19189357 CAGAGAGGCCAGGGAGAAGGTGG - Intronic
1163785865 19:19274671-19274693 CAGTGGACACCTGGGGAAGGAGG - Intergenic
1164156656 19:22601461-22601483 GAGGGAGCCCAGGAGGAAGGGGG + Intergenic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164589251 19:29497305-29497327 AAGTAGGCCCAGGGGCAAAGAGG - Intergenic
1164821459 19:31254431-31254453 CTGTGGGCCCTGGAGGAAAGGGG + Intergenic
1165062185 19:33210385-33210407 CAGTGGGCACCAGGGGCAGGTGG - Intronic
1165091303 19:33389639-33389661 GGGTGGGCCCATGGGGATGGAGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165406287 19:35633150-35633172 CAGGGGGCCCAGGCAGAGGGGGG - Exonic
1165447558 19:35864857-35864879 GAGATGGCCCAGGGGGCAGGAGG - Intronic
1165864074 19:38925407-38925429 AAGTGGGCCCAGGTGGAGGATGG + Intronic
1165958193 19:39515193-39515215 CATGGGGCCCAGGGGGACCGGGG - Exonic
1165991691 19:39818827-39818849 CACAGGGCCCAGTGGAAAGGAGG + Intergenic
1166193742 19:41193354-41193376 GCGTGGGCCCGGGGGGCAGGTGG - Exonic
1166356526 19:42230528-42230550 GAGGGGGCCAAGGGGGTAGGAGG + Exonic
1166562826 19:43744707-43744729 CACTGGGAGCAGGGGCAAGGTGG - Intronic
1167148976 19:47698284-47698306 CACTGGCCCCAGGTGGCAGGAGG + Intronic
1167171645 19:47836273-47836295 CAGTTGGCTCCGGGTGAAGGTGG - Exonic
1167194764 19:48020687-48020709 CAGAGGGCCCTGGAGGAAGGAGG - Intronic
1167427825 19:49438489-49438511 CAGACGGTCCAGGGGGAGGGAGG + Intronic
1168115879 19:54221180-54221202 CACAGGGCCCAGGGTGAAGTTGG + Exonic
1168118862 19:54240928-54240950 CACAGGGCCCAGGGTGAAGTTGG + Exonic
1168121683 19:54255383-54255405 CACAGGGCCCAGGGTGAAGTTGG + Exonic
1168125180 19:54278909-54278931 CACAGGGCCCAGGGTGAAGTTGG + Exonic
1168133928 19:54338036-54338058 CAGGGGGCCCATGGGGAACAGGG + Exonic
1168166531 19:54552133-54552155 CACAGGGCCCAGGGGGAAGTTGG - Intergenic
1168169291 19:54575433-54575455 CACAGGGCCCAGGGTGAAGTTGG - Exonic
1168172075 19:54595816-54595838 CACAGGGCCCAGGGTGAAGTTGG - Exonic
1168176794 19:54632641-54632663 CACAGGGCCCAGGGTGAAGTTGG - Exonic
1168185606 19:54697826-54697848 CACAGGGCCCAGGGTGAAGTTGG - Intronic
1168187582 19:54709732-54709754 CACAGGGCCCAGGGTGAAGTTGG - Intergenic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168635236 19:57991029-57991051 CAGTGGGACGAGGGTGCAGGAGG - Intronic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
924980332 2:214076-214098 CAGGGGCCTCGGGGGGAAGGAGG - Intergenic
925036993 2:695255-695277 CATGGAGCCCAGTGGGAAGGTGG - Intergenic
925278269 2:2665710-2665732 CAGTGAGGCCTTGGGGAAGGAGG - Intergenic
925328281 2:3039464-3039486 CAATGGGCCCTGGGGAAATGTGG + Intergenic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
926227591 2:10979259-10979281 CAGTTGACCCAGGGACAAGGGGG + Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927172123 2:20379181-20379203 TAGTGGGCCCAGAGGGACAGAGG - Intergenic
927255569 2:21037780-21037802 CAGTGAGCCTAAGGGGCAGGAGG + Intronic
927881795 2:26694266-26694288 CAATGGGCTTTGGGGGAAGGTGG - Intronic
928605134 2:32938544-32938566 CAGTGGCCCTAGGGGGAGTGAGG - Intergenic
929880340 2:45831212-45831234 CATTGGGCCCATGGGAAAGAAGG + Intronic
930226168 2:48795877-48795899 CAGTGGGCACAGGATAAAGGAGG - Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932368213 2:71166619-71166641 AACTGGGCCTAGAGGGAAGGGGG - Intergenic
932620147 2:73260368-73260390 CAGTGAGCACTGGGGGAATGAGG - Exonic
933943950 2:87268166-87268188 CAGTGGGCCCCAGGGGCAAGAGG - Intergenic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934655609 2:96115516-96115538 CAGAGGTCCCAGGGCCAAGGGGG - Exonic
935296671 2:101655988-101656010 AAGTGGGGCCAGGGGGAGGGGGG - Intergenic
936336270 2:111593413-111593435 CAGTGGGCCCCAGGGGCAAGAGG + Intergenic
936539857 2:113341292-113341314 CAGTGGGCTGAGGGGAGAGGGGG - Intergenic
936809790 2:116384335-116384357 ATGAGGGCCAAGGGGGAAGGTGG - Intergenic
936840095 2:116758349-116758371 CAGTTGGCCCAGGGAAAGGGAGG - Intergenic
937255973 2:120555790-120555812 CAGGTGGCCCAGGGGCAAGGAGG + Intergenic
938406479 2:131035752-131035774 CAGAGGGCCCACGTGCAAGGGGG - Intronic
938422355 2:131155274-131155296 CAGAGGGCGCGGGGGCAAGGCGG + Intronic
938973735 2:136456247-136456269 CAGTGGGGCCAGGAGGGTGGCGG - Intergenic
939629175 2:144513971-144513993 GAGTGGGGTGAGGGGGAAGGAGG - Intronic
940372414 2:152918069-152918091 CAGTGGGCCCAGATGCAATGCGG + Intergenic
941601733 2:167551176-167551198 CTGTGTGCCCAGGAGGAAAGGGG + Intergenic
942062508 2:172240703-172240725 CTGTGGGCCCAGGAGGGAGCAGG + Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943748427 2:191486357-191486379 CAATGGGCCCCGGGGAATGGAGG - Intergenic
945240999 2:207676891-207676913 CAGGGGGGCCAGGGGGAATCAGG - Intergenic
946057879 2:216917486-216917508 CAGTGGGCCCTGGGGGCCTGTGG - Intergenic
946297197 2:218794541-218794563 CAGTTTGCCCAGGGAGAGGGAGG + Intronic
946413267 2:219526281-219526303 GAGAGGGGCCAGGGAGAAGGAGG + Intronic
947610556 2:231522613-231522635 AAGTGGGCCTTGGGGGAGGGTGG - Intergenic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948465325 2:238149288-238149310 CAGAGGGCCCACAGTGAAGGGGG + Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
1170159748 20:13299117-13299139 CAGCGGGCCCAAGGAGAAGCTGG + Exonic
1172271939 20:33659814-33659836 GAGCGGGCCCTGGGGGAAGGGGG + Intronic
1172684842 20:36745888-36745910 CAGAGGGCCCCGGGGGCACGGGG + Intronic
1172992290 20:39045525-39045547 CAGTGGCCCCGGGAGGCAGGAGG + Intergenic
1173120824 20:40287408-40287430 GAGAGGTGCCAGGGGGAAGGAGG - Intergenic
1173207663 20:41007345-41007367 AAGTGGGCCAAGGTGGCAGGGGG + Intergenic
1173616862 20:44408940-44408962 CAGTGGGCCCTGGAGCAAGCTGG - Intronic
1173669654 20:44789877-44789899 TAATGGGCCCAGGGAGAAGAAGG + Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174881952 20:54289497-54289519 CTGTGGGGCCTTGGGGAAGGGGG + Intergenic
1175222852 20:57427139-57427161 CAGTGGGCCTGTGGGGGAGGGGG + Intergenic
1175224885 20:57439238-57439260 CAGAGGGGTCAGGGGGTAGGAGG - Intergenic
1175224923 20:57439326-57439348 CAGAGGGGTCAGGGGGATGGGGG - Intergenic
1175920980 20:62450589-62450611 GACTGTGCCCAGGGGGCAGGCGG + Intergenic
1175948905 20:62571951-62571973 AAGTGGGGCCTGTGGGAAGGCGG + Intergenic
1176061266 20:63173942-63173964 CACTGGGGCCAGGGAGGAGGGGG + Intergenic
1176097906 20:63352768-63352790 CAGAGGACCCTGGGGGAGGGGGG - Intronic
1176383777 21:6127045-6127067 CAGTGGGCCCTGGGGAAACACGG + Intergenic
1178364276 21:31975579-31975601 CAACAGGCCCAGGGTGAAGGTGG - Intronic
1178423157 21:32458134-32458156 CAGTGGGCGCAGGTGGCAAGTGG - Intronic
1178824654 21:36005007-36005029 CAGGGGGGGCAGGGGAAAGGGGG + Intergenic
1179049799 21:37879439-37879461 CAGTGGGCAGAGTGGTAAGGGGG + Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179739693 21:43411193-43411215 CAGTGGGCCCTGGGGAAACACGG - Intergenic
1180010036 21:45043560-45043582 CATCGGGCCCTGGAGGAAGGGGG - Intergenic
1180081731 21:45490358-45490380 TGGTGGGCCCAGGGTGCAGGGGG + Intronic
1180131549 21:45830081-45830103 CTGTGGCCCCAAGGGGATGGAGG + Intronic
1180229835 21:46420605-46420627 CAGTGGGACAATGGGGAATGTGG + Intronic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1180821544 22:18832351-18832373 CAGAGGGCTCACGGAGAAGGGGG + Intergenic
1181191434 22:21143694-21143716 CAGAGGGCTCACGGAGAAGGGGG - Intergenic
1181207764 22:21266816-21266838 CAGAGGGCTCACGGAGAAGGGGG + Intergenic
1181467038 22:23115910-23115932 CACAGGGCCCAGGGGGTAGGGGG - Intronic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1181628469 22:24137341-24137363 GAGTGAGCCCAGTGGGAAAGGGG - Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1183390051 22:37540614-37540636 CAGTGGGCTGAGGGAGATGGAGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183522595 22:38303998-38304020 CAGTGGGCCCAGGCAGAGAGCGG - Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183784830 22:40023310-40023332 CAGGGAGCCCAGGAGGAATGGGG - Intronic
1183807358 22:40222417-40222439 CAGAGGGCCAAGGAGGAATGGGG + Intronic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
1184251609 22:43263558-43263580 CGGTGTGTCCCGGGGGAAGGAGG - Intronic
1184274730 22:43403922-43403944 CAGTGGGCAAAGGGAGCAGGTGG + Intergenic
1184333427 22:43840081-43840103 GAGTGGGGCCAAGGGGAAGGGGG + Intronic
1184677397 22:46051148-46051170 CTCTGGGCCTAGGGGGAGGGCGG + Exonic
1185065955 22:48631822-48631844 CAGGGGGCCTAGGGGGCAGCTGG + Intronic
1185173616 22:49307112-49307134 CAGTGAGGCCAGGGCCAAGGGGG + Intergenic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
1203219156 22_KI270731v1_random:28600-28622 CAGAGGGCTCACGGAGAAGGGGG - Intergenic
1203271669 22_KI270734v1_random:58227-58249 CAGAGGGCTCACGGAGAAGGGGG + Intergenic
949536225 3:4998074-4998096 CAGTAAGCCCAGGGGAAACGCGG - Intergenic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
950128930 3:10528410-10528432 CATGGGGCCCAGAGGCAAGGTGG - Intronic
951506401 3:23449954-23449976 CAGTGGGCCCAGTGGCCAGGAGG - Intronic
951745676 3:25974656-25974678 CAGTGGGACAACTGGGAAGGGGG + Intergenic
952809284 3:37387063-37387085 CAGTGGGCCAAGGGGCCTGGGGG - Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
953990279 3:47478052-47478074 CAGTGGGCCCAGGGCTCAGGAGG - Intergenic
954150016 3:48652654-48652676 CTGTGGGTCCAGGAGGGAGGGGG - Intronic
954302257 3:49706254-49706276 TATTGGGCCCAGGGGGTGGGGGG - Intronic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
956129381 3:66039344-66039366 CAGTGGGACCTGCGGCAAGGGGG - Intergenic
957067163 3:75534248-75534270 TTGGGGGCTCAGGGGGAAGGTGG - Intergenic
957867979 3:86049692-86049714 CAGAAGGCAAAGGGGGAAGGAGG + Intronic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
960149111 3:114232682-114232704 TATTGGGCCCAGGGGGACTGGGG - Intergenic
961285987 3:125803734-125803756 TTGGGGGCTCAGGGGGAAGGTGG + Intergenic
961324273 3:126101089-126101111 CACTTGGACCCGGGGGAAGGAGG - Intronic
961384601 3:126516544-126516566 TAGTGGGCACTGGGGGGAGGGGG - Intronic
961467146 3:127088923-127088945 CAGAGGCCCCAGGGGCCAGGCGG - Intergenic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
961642183 3:128371627-128371649 CAGTGGGCACATGGGGAGGAGGG + Intronic
961900758 3:130209124-130209146 TTGGGGGCTCAGGGGGAAGGTGG - Intergenic
962006355 3:131353794-131353816 CAGTGGGCTCAGAGTAAAGGAGG + Intergenic
962712275 3:138097923-138097945 CAGGGGTCCCAAGGGGATGGGGG - Intronic
962991057 3:140577895-140577917 CAGTGGGCTTTGGGGGAAAGGGG - Intergenic
963015306 3:140818786-140818808 GTGTGGGCCCAGAGGTAAGGTGG + Intergenic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963906707 3:150779156-150779178 CGGTGTGCCCAGGGAAAAGGTGG - Intergenic
964611693 3:158622209-158622231 CAGATGGCAAAGGGGGAAGGAGG + Intergenic
965585511 3:170314372-170314394 CAGTGTGCACAGGAGAAAGGAGG - Intergenic
965615297 3:170586202-170586224 CAGGGGGGCCAGGTGGGAGGTGG - Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966480344 3:180401328-180401350 GAGTGGGGTCAGGGGGATGGAGG - Intergenic
966833990 3:184035404-184035426 AAATGGGCACAGGGAGAAGGTGG + Intronic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967330441 3:188284438-188284460 CAGGAGGCCCAAGGGGGAGGTGG + Intronic
967885079 3:194328178-194328200 CAGAGGGCCCTGGGTGAAAGAGG - Intergenic
968130140 3:196188441-196188463 CAGGGCACCCAGGGGCAAGGAGG + Intergenic
968294285 3:197561884-197561906 CAGATGGCAAAGGGGGAAGGAGG - Intronic
968652546 4:1766003-1766025 CCGTGGGCACAGGGGACAGGAGG + Intergenic
969011756 4:4070832-4070854 TTGGGGGCTCAGGGGGAAGGTGG - Intergenic
969636781 4:8374006-8374028 CAGGGGGCGCAGGGGCGAGGGGG + Intronic
969656072 4:8499269-8499291 CAGGGGGCCCAGGCTGAAGATGG - Intergenic
969686025 4:8674737-8674759 CAGTGAGCCCAGCCTGAAGGAGG + Intergenic
969727216 4:8927672-8927694 CAGATGGCAAAGGGGGAAGGAGG - Intergenic
969742328 4:9038889-9038911 TTGGGGGCTCAGGGGGAAGGTGG + Intergenic
969801711 4:9571757-9571779 TTGGGGGCTCAGGGGGAAGGTGG + Intergenic
973330258 4:48905590-48905612 CAGTGGCCACTGGGGGCAGGAGG - Intronic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
974047335 4:56908585-56908607 CGGTGGGACCCGGGGGCAGGAGG - Intronic
976771132 4:88653635-88653657 TAGTGGGTCAAGGGGGAAGCTGG + Intronic
978295452 4:107199522-107199544 AGGTGGGCCCAGGGGCAATGGGG + Intronic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
979011617 4:115377693-115377715 CTGTGGGCCGAGGGAAAAGGTGG - Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980563007 4:134502003-134502025 AGGTGGGGGCAGGGGGAAGGGGG - Intergenic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
982922261 4:161290580-161290602 CTGTGGTCCCAGGTTGAAGGAGG + Intergenic
983998429 4:174213511-174213533 CAGGGGGCTCAGTTGGAAGGTGG + Intergenic
984429052 4:179625126-179625148 CAGTAGGCCCTGGGAGAAGGAGG - Intergenic
984842440 4:184080788-184080810 CAGAAGGCCCAAGGGGAAGAAGG - Intergenic
985539939 5:483166-483188 TACTGGGCCCAGGGAGATGGAGG - Intronic
985672280 5:1213099-1213121 AAGGGGGCCCAGGGCGACGGGGG - Intronic
986008089 5:3684788-3684810 CAGCAGGCCGAGGAGGAAGGAGG - Intergenic
986418358 5:7550835-7550857 CAGGGGCCCCAGGGAGCAGGTGG - Intronic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987780587 5:22429212-22429234 CAGTGAGCCCAGGAGGGTGGGGG - Intronic
989339103 5:40354422-40354444 GAGTGGGCCAAGGTGGCAGGGGG - Intergenic
990650055 5:57888143-57888165 CAGTTGCCCCTGGGAGAAGGTGG + Intergenic
990700453 5:58469597-58469619 CAGGGGGTCGGGGGGGAAGGTGG - Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991183256 5:63778930-63778952 TAGGGGCCCCAGGGGCAAGGGGG + Intergenic
991400019 5:66242206-66242228 CATTGGGCTCAGGAGGAAGTTGG + Intergenic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
994691629 5:103026827-103026849 CAGTGGGGCCTAGGGGAAGGTGG + Intronic
994768585 5:103953858-103953880 CCGGGAGCCCACGGGGAAGGGGG + Intergenic
994979639 5:106857033-106857055 CACTGTGCACTGGGGGAAGGGGG - Intergenic
995829147 5:116334455-116334477 CAGTGGGCCCACAGGGATGGGGG - Intronic
996611216 5:125382578-125382600 AAGTGGGCCCAGGGGTATAGAGG + Intergenic
997410512 5:133687296-133687318 CAGTGAGCCCAGCGGCAGGGAGG + Intergenic
997440799 5:133907437-133907459 CCGTGGCCTCTGGGGGAAGGTGG - Intergenic
997642771 5:135460373-135460395 CAGCGTGGCAAGGGGGAAGGAGG - Intergenic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998211910 5:140206053-140206075 CAGAGGGCGCAGGGGCAAAGTGG - Intronic
998401902 5:141852705-141852727 CAGGGGTCCCATGGGGGAGGGGG - Intergenic
998451173 5:142235689-142235711 CGGTGGGGCCAGGAGGAAGTGGG - Intergenic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1001301440 5:170536592-170536614 CAGTGGGCCAAGGTGGAGTGAGG + Intronic
1002601640 5:180357064-180357086 CAGAGGGCCCAGGGGGCTGGGGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002879417 6:1238154-1238176 CTGTGGGCCCAGGGGCCAGGTGG + Intergenic
1002922792 6:1585104-1585126 CAGGGGCCCCTGGGGGAAGCCGG - Intergenic
1003554704 6:7129313-7129335 TAGTGGGGCAAGGTGGAAGGTGG + Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1005870860 6:29973849-29973871 CAGTGGTTCCAGGGGCCAGGGGG + Intergenic
1005894184 6:30163896-30163918 CAGCGGGCCCAGGGGCACAGGGG - Exonic
1006361242 6:33588595-33588617 CACTGTGCTGAGGGGGAAGGAGG + Intergenic
1006453219 6:34117402-34117424 CAGGGGGGCCTGGGAGAAGGAGG - Intronic
1006744233 6:36330309-36330331 CAGGAGGCCAAGGGGGAAGGAGG - Exonic
1006851602 6:37102661-37102683 CAGAGGGCCCCCGGGTAAGGGGG + Intergenic
1007487898 6:42194966-42194988 CAGTCGGTGCAGGGGGCAGGTGG + Intergenic
1008693838 6:54010856-54010878 AAGTGGTCCCAGTGGGAATGAGG + Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1012804716 6:103879295-103879317 CAGTTTGCACAGGGAGAAGGAGG - Intergenic
1017042355 6:150317602-150317624 CAGTTGCCCCAGGGGGTGGGGGG + Intergenic
1017493322 6:154962891-154962913 CAGAGGGCACATGGGGAAGGTGG + Intronic
1017589695 6:155965593-155965615 CAGTGAGCCTAGGAGGTAGGTGG - Intergenic
1018033957 6:159866351-159866373 CAGTAGGCCCTGGAGAAAGGAGG + Intergenic
1018267348 6:162039524-162039546 CAGAGGTCCCATGGGGAAAGGGG - Intronic
1018728817 6:166633902-166633924 CAGCTGGCCCATGGGGAGGGAGG + Intronic
1019173235 6:170146524-170146546 CAGTGGGCCCACAGGAACGGTGG + Intergenic
1019402977 7:866786-866808 CTGAAGGCCCAGGGAGAAGGGGG - Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1019889930 7:3938244-3938266 CAGTGGACCAAGGGGTAAGAGGG - Intronic
1020051714 7:5086242-5086264 CAGGGGGGCCAGGGACAAGGTGG + Intergenic
1020474914 7:8583002-8583024 AAGGGGGCCAAGGGGGCAGGTGG + Intronic
1021081169 7:16367214-16367236 CAGTGGGCACAGGGAGCAAGGGG - Intronic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1022089150 7:27096480-27096502 CAGCGCGCCCAGCCGGAAGGCGG + Intergenic
1023817348 7:43961338-43961360 CAGAGGTCCCAGTGGGTAGGGGG + Intergenic
1023839628 7:44089058-44089080 GAGCAGGCCCAGAGGGAAGGAGG - Intergenic
1023984896 7:45088718-45088740 GAGGGGGGCCAGGGGGATGGGGG + Intronic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1025022397 7:55489879-55489901 CAGGGGACCCAGGGAGAAAGTGG + Intronic
1026665647 7:72337645-72337667 ACCTGAGCCCAGGGGGAAGGCGG + Intronic
1026727273 7:72879578-72879600 CAGAGGGGCCAGGCGGGAGGTGG + Exonic
1027858135 7:83539199-83539221 CTGGGAGCCCAGGGGGAAGCTGG + Intronic
1028872711 7:95786765-95786787 TGGTGGGGCCAAGGGGAAGGAGG - Intronic
1029514691 7:101017867-101017889 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514712 7:101017908-101017930 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514733 7:101017949-101017971 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514754 7:101017990-101018012 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514775 7:101018031-101018053 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514796 7:101018072-101018094 GAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514817 7:101018112-101018134 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514861 7:101018196-101018218 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029741974 7:102496212-102496234 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1029759963 7:102595377-102595399 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1030735533 7:113043495-113043517 CAGGGAGCCCAAGGGGAGGGAGG + Intergenic
1030820706 7:114087548-114087570 CAGTGGCCCCGGCGGGCAGGCGG + Intronic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032060148 7:128717278-128717300 CATTGGGCCCAAGGGCAAGGAGG + Intronic
1032396381 7:131592960-131592982 CAGTTGCCCCTGGGGGTAGGAGG + Intergenic
1032420944 7:131778626-131778648 CAGAGGGCCTAGGGGTTAGGAGG - Intergenic
1032528067 7:132594808-132594830 CACTGAGCCCTGGGAGAAGGTGG + Intronic
1032586840 7:133154650-133154672 CAGAGGGCCCTGTGTGAAGGAGG + Intergenic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033246438 7:139720352-139720374 CCATGGGCCCAGGGTGGAGGTGG - Intronic
1033460316 7:141541612-141541634 AAGGGAGCCCAGGGAGAAGGAGG - Intergenic
1034589371 7:152127037-152127059 CAGGGGTCCCTGGGGGAGGGAGG + Intergenic
1034939533 7:155221261-155221283 CAGTGAGCTCAGGGGGAACCAGG - Intergenic
1035546104 8:483529-483551 CACTGGGCCCAGGGAGCAGAAGG - Intergenic
1036106102 8:5842142-5842164 CAGTGGTCCCAGGGTGGAGTCGG + Intergenic
1036247534 8:7131499-7131521 TTGGGGGCTCAGGGGGAAGGTGG + Intergenic
1036886733 8:12562504-12562526 TTGGGGGCTCAGGGGGAAGGTGG - Intergenic
1037928521 8:22864061-22864083 CTGTGTGCCCAGGAGCAAGGCGG - Intronic
1037988584 8:23304852-23304874 CAGTGGGGGCACGGGGAACGGGG + Intronic
1038103905 8:24412132-24412154 CAGTGGGGCCAGTTGGAGGGTGG + Intergenic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038339740 8:26675327-26675349 AATGGGGGCCAGGGGGAAGGGGG - Intergenic
1038434908 8:27528696-27528718 CAGTGCTCCTAGGGAGAAGGAGG - Intronic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039254225 8:35701381-35701403 GAGTAGGCCCTGGGGGAAGATGG - Intronic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039721498 8:40169305-40169327 CAGTGGGGTCAGGGGAAAGTGGG + Intergenic
1041192427 8:55367133-55367155 CGGTGGGCACACAGGGAAGGAGG - Intronic
1041304720 8:56447062-56447084 GAGGGGGCCCAGGGAGGAGGCGG - Intergenic
1041793448 8:61721973-61721995 GAGTGGGGACAGGAGGAAGGAGG - Intergenic
1045056406 8:98371970-98371992 GAGTGGGATCAGGGGGAGGGGGG + Intergenic
1045498966 8:102730562-102730584 CAGTGAGTCCAGGTGGGAGGTGG - Intergenic
1046086703 8:109445515-109445537 CAGTGGTCCCAGCGGGAGTGCGG - Exonic
1046596149 8:116263643-116263665 CTGTGGGCCCTGGGGGAATTAGG + Intergenic
1046986280 8:120391817-120391839 CAGTTGGGACAGGGGGATGGGGG - Intronic
1047132126 8:122033172-122033194 CAGTGGGCTCAGGGGTCAAGTGG + Intergenic
1048278585 8:133087773-133087795 CAGTGGGGCCAGGCAGCAGGAGG + Intronic
1049064315 8:140301004-140301026 CCATGGGTCCATGGGGAAGGTGG - Intronic
1049233296 8:141495284-141495306 CAGGGGGCAGAGGGGGAGGGTGG - Intergenic
1049346832 8:142143697-142143719 CAGAGGAGCCAGTGGGAAGGGGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049405495 8:142450268-142450290 CAGGGGGCTGAGGGGGTAGGGGG - Intronic
1049409578 8:142466482-142466504 CAGTGGCCCGAGGAGGAGGGAGG + Intronic
1049706213 8:144044051-144044073 GAGTGAGTGCAGGGGGAAGGTGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050094192 9:2047140-2047162 CACTGGGCCCCGGGGGGCGGCGG + Intronic
1050183175 9:2942465-2942487 CAGTTGGGGCAGGGGGACGGTGG - Intergenic
1050460827 9:5875969-5875991 CAGAGGGGCCATGGGGCAGGGGG + Intergenic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050567382 9:6900480-6900502 CAGTGGAGCCAGGGGCATGGTGG + Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1052832693 9:33228924-33228946 CAGGGGGTCCAGGCAGAAGGTGG - Intronic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053418693 9:37963163-37963185 CAGTGGCCCCCGGGGATAGGGGG + Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1054718693 9:68582367-68582389 CAGGGGGTCCAGGGAGAAGAAGG + Intergenic
1056250668 9:84744947-84744969 AAGTGGGCAAAGGGGGAATGAGG - Intronic
1056297329 9:85206003-85206025 CACTGGTCCCAGGAGGAAGATGG + Intergenic
1056779089 9:89535914-89535936 AAGTGGGGCCAAGAGGAAGGGGG + Intergenic
1057083570 9:92189700-92189722 CACTGGGCCACGGGGGCAGGGGG - Intergenic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1058860458 9:109113075-109113097 CAGCGGGGCCAGGGGCAGGGCGG + Intronic
1059326418 9:113506541-113506563 CAGTGTGCCCAGGGGTGGGGAGG - Intronic
1059416983 9:114168410-114168432 CAGGGGACCCAGGGGGACTGTGG + Exonic
1060036593 9:120261331-120261353 CAGAGGGGCCAGGGATAAGGCGG + Intergenic
1061033206 9:128099261-128099283 CAGTGGGCACTGGGGGTAGCAGG - Intronic
1061178543 9:129011177-129011199 CACTGGGCACAGGGAGGAGGCGG + Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061493542 9:130959245-130959267 CACTGGGCCCTGTGGGCAGGTGG - Intergenic
1061898025 9:133658603-133658625 CAGGGGACCCTGGGGGAAGAAGG - Exonic
1062179915 9:135185776-135185798 CAGTGGCCTTAGGGGGAAGCCGG - Intergenic
1062207087 9:135343180-135343202 CAGTGGGACCTGGTGGAGGGTGG - Intergenic
1062295814 9:135825936-135825958 CAGGGAGCCCGGGGGGAAGCTGG + Intronic
1062343012 9:136102126-136102148 CAGCTGGCCCAGAGGGAAAGTGG + Intergenic
1062541808 9:137044875-137044897 CACTGAGCCCAGGAGGAAGCCGG + Intronic
1062551547 9:137089772-137089794 GAGTGGGCCTTGGGAGAAGGAGG + Intronic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1062625038 9:137438741-137438763 CAGAGGGCCCTGTGGGAGGGGGG + Intronic
1185475664 X:413906-413928 CCGTGGGTCCTGGAGGAAGGAGG - Intergenic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1187469234 X:19553298-19553320 CAGTGGGCCCAGGAGGGTCGGGG - Intronic
1187759160 X:22560831-22560853 AAGTAGTCCCAGGGGAAAGGGGG + Intergenic
1189332146 X:40151001-40151023 CAGCTGGCCAAGGGGAAAGGAGG + Intronic
1189332793 X:40153611-40153633 CAGCGAGCCCAGGGGAAAGGGGG - Intronic
1190301304 X:49059111-49059133 CAGTGGGCCCAGGGTGCGAGGGG + Intronic
1190455126 X:50619489-50619511 CTGTGGGCCCGGGGGCAAGCAGG - Intronic
1190732345 X:53234303-53234325 CAGCGGGCCATGGGGGGAGGTGG + Exonic
1191257969 X:58287951-58287973 CACTGGGCCCAGGGGGTTTGTGG + Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192296442 X:69854164-69854186 CAGTGGGGCCTGTCGGAAGGTGG - Intronic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1193753637 X:85379268-85379290 CAGTGGGCCCATGAACAAGGTGG - Exonic
1193986410 X:88246172-88246194 CAGTGGGTCTAGTGGGAGGGTGG - Intergenic
1195004519 X:100672740-100672762 GAGTGGGCTCAGGAGGAAAGAGG + Intergenic
1195048776 X:101078610-101078632 AAGTGAGCCCGGTGGGAAGGTGG + Intergenic
1195218317 X:102721917-102721939 CAGTGGGTGCATGGGGTAGGGGG - Intronic
1195249823 X:103032139-103032161 CAGAGGGCCCAAGGGGGATGTGG + Intergenic
1196772718 X:119310855-119310877 CAGATGGCATAGGGGGAAGGAGG - Intergenic
1197042668 X:121958333-121958355 CAGATGGCAAAGGGGGAAGGAGG - Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197256861 X:124272887-124272909 CACTGGGGCCATGGGGAAGGTGG + Intronic
1197874461 X:131088731-131088753 CCGTGTGCCCCGGGAGAAGGAGG + Exonic
1198167626 X:134072731-134072753 CAGTGGGCACAGGCCGAGGGTGG + Intergenic
1199707783 X:150445619-150445641 CAATGGGCCATGGGGGGAGGGGG + Intronic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1199885349 X:152015677-152015699 CATTGGTCCCAGGGGTGAGGGGG + Intergenic
1199976716 X:152898601-152898623 AAATGGGCACAGGGGGACGGAGG - Intergenic
1200118415 X:153779256-153779278 CAATGGGGAGAGGGGGAAGGAGG - Exonic
1201291064 Y:12421176-12421198 CAGTGGGCACGGGGAGACGGAGG - Intergenic