ID: 1138590377

View in Genome Browser
Species Human (GRCh38)
Location 16:57996323-57996345
Sequence GCTCGTACTCCTGGCACCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138590377_1138590386 24 Left 1138590377 16:57996323-57996345 CCGCTGGTGCCAGGAGTACGAGC 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1138590386 16:57996370-57996392 CCCCTGCGTCCTCACTCCCGAGG 0: 1
1: 1
2: 2
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138590377 Original CRISPR GCTCGTACTCCTGGCACCAG CGG (reversed) Exonic
901095513 1:6676153-6676175 GCATGTCCTCCTGGCTCCAGTGG - Intronic
901383363 1:8890113-8890135 GCACGGACTCCTGGCAAGAGAGG + Intergenic
902406144 1:16184684-16184706 GCTCGGACTCCTGGATCCGGTGG - Intergenic
911033827 1:93517408-93517430 CCTCGAACTCCTGGCCCCAAGGG + Intronic
918400473 1:184157669-184157691 GCTCGTTCTCCTGTAGCCAGGGG - Intergenic
919528037 1:198679205-198679227 GCTCGTGCTCGTGGCCCCAGTGG - Intronic
924707331 1:246511018-246511040 GCTCGTTGTCCTGGCACCCTTGG + Intergenic
1064162662 10:12959384-12959406 TCTCGAACTCCTGGCCTCAGGGG + Intronic
1065365865 10:24936502-24936524 TCTCGAACTCCTGGCTTCAGGGG + Intronic
1065373917 10:25017110-25017132 GGTCGTTCTCCAGGAACCAGTGG + Intronic
1065822510 10:29538943-29538965 GCTCGAACTCCTGGCCTCAAGGG - Intronic
1065934455 10:30508623-30508645 TCTCATTTTCCTGGCACCAGTGG + Intergenic
1067064503 10:43096179-43096201 ACTCCCACTCCTGGCACCATGGG - Intronic
1072093542 10:92153560-92153582 TCTCGAACTCCTGACCCCAGGGG - Intronic
1075555193 10:123425784-123425806 GCTCCGACTCCTGGGGCCAGTGG - Intergenic
1075712962 10:124540517-124540539 CCTCGTGCTCCTGGCCCCACTGG + Intronic
1076454035 10:130576940-130576962 GCTGTTACTCCTTGCAACAGTGG + Intergenic
1078633213 11:13024559-13024581 TCTCGTCCTCCTTGAACCAGAGG + Intergenic
1079116163 11:17641840-17641862 GCTCGTACTCCTGGTTCTACAGG - Exonic
1081907476 11:46678967-46678989 ACTCTTCCTCCTGGCATCAGGGG - Exonic
1087573118 11:99955821-99955843 GCCCGTACTCCTGGCACTTTAGG - Intronic
1090207791 11:124895532-124895554 ACTCGTAGTCTTGGCCCCAGTGG + Exonic
1090582834 11:128178767-128178789 GCCTGTAATCCTGGCACCATAGG - Intergenic
1090678786 11:129030932-129030954 GCTCCTACTCCTGCCACATGAGG + Intronic
1093063640 12:14633072-14633094 GCTGCTACTGCTGGCACCTGAGG + Intronic
1096993317 12:55822382-55822404 TCTCGGATTCCAGGCACCAGAGG - Exonic
1099850922 12:88096265-88096287 TCTCGAACTCCTGACCCCAGGGG + Intronic
1100823835 12:98456742-98456764 TATGGTACCCCTGGCACCAGGGG - Intergenic
1102613783 12:114135200-114135222 TCTCGTGTTCCTAGCACCAGTGG + Intergenic
1105482534 13:20792225-20792247 TCTCGAACTCCTGGCCTCAGGGG - Intronic
1106455278 13:29921378-29921400 TCTCCTCCTCCTGCCACCAGTGG + Intergenic
1106929824 13:34652141-34652163 GCTTGTACTCCTTGAAACAGTGG - Intergenic
1114339844 14:21731428-21731450 TCTCGAACTCCTGGCCTCAGGGG + Intergenic
1120055730 14:79921946-79921968 TCTCGAACTCCTGGCCCCAAGGG + Intergenic
1121839081 14:97117855-97117877 GCTCACACTCCTGGCACCCCTGG - Intergenic
1121959045 14:98241451-98241473 GCTCCTACTCCTGGGAACATGGG - Intergenic
1125527252 15:40384465-40384487 AATGGTAATCCTGGCACCAGCGG + Intronic
1126988531 15:54343349-54343371 GCTCGAACTCCTGACCTCAGGGG + Intronic
1127170343 15:56294101-56294123 GGTCCTAGTCATGGCACCAGGGG - Intronic
1129375718 15:75129821-75129843 CCTCGTTCTCCTGGGACCAGCGG + Intergenic
1131901223 15:97089901-97089923 GCCCTCACTCCTGGCACCAGTGG + Intergenic
1132291808 15:100709102-100709124 GCTCTTACTCATGTCACCAGTGG - Intergenic
1132847206 16:2006101-2006123 GCAGGTACTCCGAGCACCAGGGG + Intronic
1134240827 16:12505008-12505030 GCTCATACTCCTGGGACCTTGGG + Intronic
1134298629 16:12969523-12969545 TCTCGAACTCCTGGCCTCAGGGG - Intronic
1136462833 16:30422565-30422587 TCTCGAACTCCTGACATCAGGGG + Intronic
1137581300 16:49635091-49635113 GCTGGTACTCTTATCACCAGTGG - Intronic
1138590377 16:57996323-57996345 GCTCGTACTCCTGGCACCAGCGG - Exonic
1139870180 16:70101826-70101848 CCTCGAACTCCTGGCTCAAGGGG - Intergenic
1140385264 16:74530719-74530741 CCTCGAACTCCTGGCTCAAGGGG + Intronic
1140894219 16:79310962-79310984 GCTCGCGCTCCTGGGAGCAGTGG - Intergenic
1143334798 17:6164184-6164206 TCTCATTCTCCTGGGACCAGTGG + Intergenic
1147522406 17:41187095-41187117 GCTCCTTCTGCTGTCACCAGAGG - Intergenic
1148843872 17:50517239-50517261 GCTCTTCCTCCTGCCACCACAGG + Intronic
1151276944 17:73041978-73042000 GCTGGTACCTCTGACACCAGAGG - Intronic
1151568620 17:74914963-74914985 GCTCCTGCTCCTGGCACCCCAGG + Intergenic
1151596155 17:75079051-75079073 AGTCTTCCTCCTGGCACCAGTGG + Intergenic
1152896699 17:82915453-82915475 GCTCATCTTCCTGGCACCGGGGG - Intronic
1153547305 18:6220872-6220894 GCTGGTACTGGTGGCATCAGAGG + Intronic
1158934774 18:62354461-62354483 ACTCGCAGTCCTGGCTCCAGTGG - Exonic
1159166048 18:64702372-64702394 ACTCATACCCCTGGGACCAGAGG - Intergenic
1159672519 18:71239332-71239354 GGTCAGGCTCCTGGCACCAGAGG + Intergenic
1160850549 19:1189569-1189591 CCTCTTCCTCCAGGCACCAGTGG + Intronic
1161187647 19:2932562-2932584 TCTCGAACTCCTGACATCAGGGG - Intergenic
1161232127 19:3179629-3179651 GCAGGTACTCCTGGGCCCAGAGG - Exonic
1161979103 19:7621288-7621310 GCTCGTACGCCTGTTACCAGAGG + Exonic
1162003634 19:7763776-7763798 GCCTGGACTCCTGGAACCAGAGG + Intronic
1162491462 19:10995044-10995066 GCTGGTACTGCGGGCTCCAGGGG + Intronic
1163944917 19:20527021-20527043 TCTCATACTTCTGGCACCAATGG + Intergenic
1164187194 19:22880660-22880682 GCTCAAACTCCTGGCTCCAGTGG + Intergenic
1166599070 19:44077940-44077962 CCTAGTACTCCAGGCACCAAAGG + Intronic
1167338438 19:48900709-48900731 GCCCGAACTCCTGGTTCCAGGGG + Intronic
1167403040 19:49285674-49285696 GCTCGAACTCCTGGCCTCAAGGG - Intergenic
927776544 2:25908222-25908244 TCTCGAACTCCTGGCCTCAGGGG - Intergenic
928424766 2:31168860-31168882 GCTCGGATTTCAGGCACCAGAGG + Intergenic
929571696 2:43026901-43026923 GCCCCCACTCCTGGCCCCAGAGG + Intergenic
932197338 2:69796054-69796076 GCTCAGACCCCTGGCTCCAGTGG - Intronic
937530320 2:122819928-122819950 TCTCGAACTCCTGGCCTCAGGGG + Intergenic
939170445 2:138689313-138689335 TCTCAGACTCCTGGCCCCAGAGG + Intronic
940925143 2:159356108-159356130 GCTGGCACTCCAGGCACCACTGG - Intronic
943182392 2:184560691-184560713 GCTTATGCTCCTGGCACCAAGGG + Intergenic
945643050 2:212454694-212454716 GCTCTTACTCCTAGCACTGGAGG - Intronic
945690045 2:213022323-213022345 GATCGTACCTCTGGCAACAGGGG + Intronic
948216740 2:236237933-236237955 GCTTGTACTCCAGGGTCCAGAGG + Exonic
948458051 2:238116406-238116428 GCTGGTGCTCCAGGCACTAGGGG + Intronic
948670718 2:239566911-239566933 TCTCTTGCCCCTGGCACCAGTGG - Intergenic
948695587 2:239731682-239731704 GAGCGCACTCCTGGCTCCAGTGG + Intergenic
948845614 2:240681546-240681568 GCTCGTGCTCCAGGCACCACAGG - Intronic
948848241 2:240693184-240693206 GCTCGTGCTCCAGGCACCACAGG + Intronic
1173760106 20:45552449-45552471 GCTAATACTCCTGCCACCTGTGG - Intronic
1175862845 20:62159395-62159417 CCTCGTATACCTCGCACCAGTGG - Intronic
1176125795 20:63473909-63473931 GCACGTTCGCCTGGCACCATGGG + Intergenic
1178309516 21:31518167-31518189 GCTCATACCCAAGGCACCAGGGG - Intronic
1181286255 22:21754595-21754617 GCTTTTACTCCTGGCAGAAGGGG + Exonic
1182230623 22:28835221-28835243 TCTCGAACTCCTGGCCCCAAGGG + Intergenic
1182664844 22:31950383-31950405 GCCCCTACTCCTGGCTGCAGTGG + Intronic
1184354001 22:43966057-43966079 TCTGGAACTCCTGGCACAAGGGG + Intronic
1184718235 22:46294150-46294172 TCTCGAACTCCTGACATCAGGGG - Intergenic
1184735996 22:46398161-46398183 GCTGGAACCCCTGGCTCCAGGGG + Intronic
1185185644 22:49398123-49398145 CTCCGTACTCCTGGCACCCGGGG - Intergenic
950389113 3:12682725-12682747 GCTTTCATTCCTGGCACCAGGGG - Intergenic
951569706 3:24049059-24049081 GCTGGGACTCCTGGTACCATGGG + Intergenic
953027291 3:39152597-39152619 GCCCACACTCCTGACACCAGAGG - Intronic
953174477 3:40537381-40537403 TCTCGGACTCCTGGCTTCAGGGG - Exonic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
954737168 3:52715981-52716003 GCTTCCACTGCTGGCACCAGGGG - Intronic
962320637 3:134387748-134387770 GATCGTACTCATGAGACCAGTGG - Intergenic
964415160 3:156439762-156439784 TCTCTTCCTGCTGGCACCAGGGG - Intronic
969731185 4:8959074-8959096 GCTCTTACTCCTCGCATCACGGG - Intergenic
970349184 4:15183999-15184021 CCTCGTAGCCCTGGCTCCAGAGG - Intergenic
971685296 4:29757620-29757642 GCTGGGACTACAGGCACCAGTGG - Intergenic
980438546 4:132812764-132812786 GTTCGTACCCCTGACACAAGTGG + Intergenic
981443443 4:144809000-144809022 GCTGGTGTTCCTGGCACCACTGG - Intergenic
989167947 5:38448979-38449001 GCTGGGACTTCTGCCACCAGGGG - Intronic
989279081 5:39621215-39621237 GCTTCTACTGCTGGCACCAGGGG + Intergenic
992427409 5:76671858-76671880 GCGCCAACTCCTGGCTCCAGTGG + Exonic
1000209417 5:159096654-159096676 GCTCGTGCCCCGGCCACCAGAGG + Intronic
1003045339 6:2728578-2728600 CCTCATCCTCCTGGCCCCAGTGG + Intronic
1003045450 6:2729281-2729303 CCTCATCCTCCTGGCCCCAGTGG - Intronic
1003635139 6:7825194-7825216 GCTTGAACTCCTGGAACTAGAGG - Intronic
1007443914 6:41889249-41889271 TCTCAAACTCCTGGCACCAAGGG + Intronic
1008613077 6:53202051-53202073 CCTCATACTCCTGGCCCCAAGGG + Intergenic
1009727895 6:67558362-67558384 GCTGGTGCTCCACGCACCAGTGG + Intergenic
1014110955 6:117617853-117617875 TCTCCCACTCCTGCCACCAGCGG - Intergenic
1017831835 6:158137655-158137677 TCTCGAACTCCTGGCTCAAGAGG - Intronic
1017977804 6:159373595-159373617 GCCTGTGCTCCTGGGACCAGAGG - Intergenic
1019585756 7:1802364-1802386 GCTTGTAATCCTGGCACTTGGGG + Intergenic
1025868228 7:65405899-65405921 GCTCAAATTCCTGGCTCCAGTGG + Intergenic
1029389253 7:100264042-100264064 GCCTGTAATCCTGGCACCTGTGG - Intronic
1031646403 7:124231189-124231211 TCTCGAACTCCTGACCCCAGGGG + Intergenic
1034347608 7:150397051-150397073 GCTCGCACTCGGGGCACGAGTGG - Exonic
1036751077 8:11444115-11444137 GCTGGCACTCCTGGCAGAAGGGG + Exonic
1037321357 8:17646326-17646348 GCTCATAATCCTGGCACCTTGGG + Intronic
1039215205 8:35262134-35262156 GCTCTTACTCATTGCACCAGAGG - Intronic
1039841427 8:41296001-41296023 CCTCTTACTGCTGGCACCTGGGG - Intronic
1041179287 8:55230862-55230884 TCTCCTACTCCGAGCACCAGTGG - Intronic
1042553494 8:70014894-70014916 GCTCGAACTCCTGGACTCAGAGG + Intergenic
1045732784 8:105261567-105261589 GCTCATACTCCTGGCACTTTTGG - Intronic
1051694452 9:19753040-19753062 AATCTTACTCCTGGCACCTGAGG - Intronic
1059414706 9:114155734-114155756 GCCCGGACTCCTGGGACCATGGG + Exonic
1059437065 9:114283490-114283512 CCTCCTTCTCCTGGCTCCAGGGG - Intronic
1061798697 9:133102891-133102913 CCTCGAACTCCTGGGGCCAGAGG + Exonic
1061960558 9:133986806-133986828 GCCCCTTCTGCTGGCACCAGGGG + Intronic
1062282243 9:135757240-135757262 GCCCGCACTCCTGGCAGCTGGGG - Intronic
1189187458 X:39066449-39066471 GCTCACACTCCTAGCACCAGTGG + Intergenic
1190736086 X:53256651-53256673 GCCCGGAGTCCAGGCACCAGGGG - Intronic
1191969641 X:66799151-66799173 GCTGGTATTCCAGGCACCACTGG - Intergenic
1197355917 X:125437393-125437415 GCTCAAACTCCTGGCTCCAGTGG - Intergenic
1198243713 X:134808733-134808755 TCTCGAACTCCTGGCCTCAGGGG + Intronic
1198378018 X:136058629-136058651 TCTCGAACTCCTGGCCTCAGGGG - Intergenic
1202411961 Y:24583469-24583491 GCTCCTCCTCCTTGCACAAGGGG + Intergenic