ID: 1138590430

View in Genome Browser
Species Human (GRCh38)
Location 16:57996547-57996569
Sequence GCCCTCCGCTGCCGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138590423_1138590430 15 Left 1138590423 16:57996509-57996531 CCGCAGAGTCAGGGCAGGCAGGC 0: 1
1: 0
2: 4
3: 48
4: 434
Right 1138590430 16:57996547-57996569 GCCCTCCGCTGCCGCGGCGGCGG 0: 1
1: 0
2: 2
3: 30
4: 264
1138590420_1138590430 21 Left 1138590420 16:57996503-57996525 CCACAGCCGCAGAGTCAGGGCAG 0: 1
1: 0
2: 1
3: 38
4: 334
Right 1138590430 16:57996547-57996569 GCCCTCCGCTGCCGCGGCGGCGG 0: 1
1: 0
2: 2
3: 30
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138590430 Original CRISPR GCCCTCCGCTGCCGCGGCGG CGG Exonic