ID: 1138590652

View in Genome Browser
Species Human (GRCh38)
Location 16:57997992-57998014
Sequence GCGGACTGGACAGGTGCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138590647_1138590652 -2 Left 1138590647 16:57997971-57997993 CCGCCAGACACTGGTGCTCATGC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1138590652 16:57997992-57998014 GCGGACTGGACAGGTGCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1138590646_1138590652 -1 Left 1138590646 16:57997970-57997992 CCCGCCAGACACTGGTGCTCATG 0: 1
1: 0
2: 4
3: 65
4: 628
Right 1138590652 16:57997992-57998014 GCGGACTGGACAGGTGCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1138590649_1138590652 -5 Left 1138590649 16:57997974-57997996 CCAGACACTGGTGCTCATGCGGA 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1138590652 16:57997992-57998014 GCGGACTGGACAGGTGCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138590652 Original CRISPR GCGGACTGGACAGGTGCGCC AGG Exonic