ID: 1138595972

View in Genome Browser
Species Human (GRCh38)
Location 16:58029106-58029128
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4130
Summary {0: 1, 1: 0, 2: 3, 3: 176, 4: 3950}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138595972 Original CRISPR AAAGGCGGGTGGATCGGTTT TGG (reversed) Intronic
Too many off-targets to display for this crispr