ID: 1138597775

View in Genome Browser
Species Human (GRCh38)
Location 16:58038326-58038348
Sequence AGCGCTTCCGACGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138597775_1138597787 30 Left 1138597775 16:58038326-58038348 CCTGCGGCGGCGTCGGAAGCGCT 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1138597787 16:58038379-58038401 ACCATCTGACCTTTAGGTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
1138597775_1138597786 29 Left 1138597775 16:58038326-58038348 CCTGCGGCGGCGTCGGAAGCGCT 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1138597786 16:58038378-58038400 CACCATCTGACCTTTAGGTAGGG 0: 1
1: 0
2: 0
3: 14
4: 76
1138597775_1138597778 -6 Left 1138597775 16:58038326-58038348 CCTGCGGCGGCGTCGGAAGCGCT 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1138597778 16:58038343-58038365 AGCGCTACGCCCTCACCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 28
1138597775_1138597783 24 Left 1138597775 16:58038326-58038348 CCTGCGGCGGCGTCGGAAGCGCT 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1138597783 16:58038373-58038395 ACAACCACCATCTGACCTTTAGG 0: 1
1: 0
2: 0
3: 9
4: 132
1138597775_1138597777 -9 Left 1138597775 16:58038326-58038348 CCTGCGGCGGCGTCGGAAGCGCT 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1138597777 16:58038340-58038362 GGAAGCGCTACGCCCTCACCGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1138597775_1138597779 0 Left 1138597775 16:58038326-58038348 CCTGCGGCGGCGTCGGAAGCGCT 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1138597779 16:58038349-58038371 ACGCCCTCACCGGGAGGAAGTGG 0: 1
1: 0
2: 1
3: 7
4: 129
1138597775_1138597776 -10 Left 1138597775 16:58038326-58038348 CCTGCGGCGGCGTCGGAAGCGCT 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1138597776 16:58038339-58038361 CGGAAGCGCTACGCCCTCACCGG 0: 1
1: 0
2: 0
3: 0
4: 13
1138597775_1138597785 28 Left 1138597775 16:58038326-58038348 CCTGCGGCGGCGTCGGAAGCGCT 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1138597785 16:58038377-58038399 CCACCATCTGACCTTTAGGTAGG 0: 1
1: 0
2: 1
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138597775 Original CRISPR AGCGCTTCCGACGCCGCCGC AGG (reversed) Exonic