ID: 1138598018

View in Genome Browser
Species Human (GRCh38)
Location 16:58039813-58039835
Sequence AAGGGCCTACTATCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138598018 Original CRISPR AAGGGCCTACTATCCTCTGC TGG (reversed) Intronic
900640284 1:3685134-3685156 AGGGGCCTTCTGCCCTCTGCAGG - Intronic
901589111 1:10324518-10324540 AATGGCCACCTATCCTCTACCGG - Intronic
902808877 1:18877233-18877255 AAGGTCCCAAAATCCTCTGCAGG + Exonic
904326210 1:29728275-29728297 CAGGGCCTTCTGTCCTCTGGGGG + Intergenic
904433297 1:30478983-30479005 CAGGGCCTTCTGTCCTCTGGAGG - Intergenic
906150695 1:43585805-43585827 AAGGACCTACTTCCTTCTGCTGG + Intronic
906573074 1:46861737-46861759 AAGAGCCCACTAACCTTTGCAGG + Intergenic
906598797 1:47105427-47105449 AAGAGCCCACTAACCTTTGCAGG - Intronic
906695514 1:47820672-47820694 AAGGGCCCACTTTCCCCTGTTGG + Intronic
907355815 1:53873121-53873143 AAGTACCCACTACCCTCTGCTGG + Intronic
909509890 1:76440504-76440526 AAGGGCAAAATATCCACTGCAGG + Intronic
909901453 1:81141504-81141526 AAGGGTTTAATATCCTATGCAGG - Intergenic
912856069 1:113169720-113169742 CAAGGCCTACTTTCCTCTTCTGG - Intergenic
916688402 1:167168699-167168721 AAGCGCCGACTTTTCTCTGCAGG + Intergenic
920353894 1:205356364-205356386 AAGGGCCTTTTCTCCTCAGCTGG - Intronic
923678473 1:236100254-236100276 AATGACCTCCTGTCCTCTGCTGG + Intergenic
923729476 1:236536657-236536679 CAGGGCCTGCTCTTCTCTGCTGG - Intronic
1063955122 10:11258453-11258475 AAGTGCCTACAATCTTCTTCAGG - Intronic
1063975214 10:11409504-11409526 CAGAGCCTACTTTCCTCTTCGGG - Intergenic
1067283039 10:44887322-44887344 AAGGCCCTTCTCTCCTCTGGAGG - Intergenic
1071293693 10:84204370-84204392 ATGGCCCTACTCTCCTCTGCAGG - Intronic
1072831665 10:98664368-98664390 CAGGGCCTACCTTCTTCTGCAGG + Intronic
1076946355 10:133653871-133653893 AATGGCCAACTGTCCTCTGCAGG + Intergenic
1077242983 11:1520804-1520826 AAGTGCATTCTATCCTATGCTGG + Intergenic
1084875487 11:72129251-72129273 CAGGGGCTACTATCTTCTACAGG - Intronic
1088349645 11:108871352-108871374 AAGGGCATCCTGCCCTCTGCTGG + Intronic
1088404469 11:109458027-109458049 GAGGGCAGAATATCCTCTGCTGG + Intergenic
1095089485 12:38090483-38090505 AACAGCCAACTGTCCTCTGCAGG - Intergenic
1098932483 12:76435916-76435938 AAGGGCCTACTACTCTTTCCAGG + Intronic
1100804106 12:98262875-98262897 AAGGCCCTCCTATCATCTGGTGG - Intergenic
1103024629 12:117563663-117563685 AAGCCCCTAAGATCCTCTGCTGG + Intronic
1106017725 13:25885010-25885032 CAGGGCCCACTATCCTGAGCTGG + Intronic
1121167831 14:91824344-91824366 AAGGGCTTATTTGCCTCTGCTGG + Intronic
1122304143 14:100751008-100751030 AAGGACTTTCTATCCTCTTCTGG + Intergenic
1202924472 14_KI270724v1_random:11150-11172 AATGGCCAAGTGTCCTCTGCAGG - Intergenic
1128354573 15:66915811-66915833 AAGGCCCCACCATCCTCAGCAGG + Intergenic
1128550419 15:68594776-68594798 AAGGGCTTTCTGTCCTCTCCAGG - Intronic
1128931967 15:71713340-71713362 GAGCTCCTAGTATCCTCTGCAGG + Intronic
1129459897 15:75695321-75695343 CAGGCTCTACTCTCCTCTGCTGG - Intronic
1132938149 16:2492542-2492564 ATGGGCCCACTAGCCTCTGGAGG - Intronic
1134663463 16:16001546-16001568 AATGGCCTTCTCTCTTCTGCTGG - Intronic
1137240162 16:46649190-46649212 AAGGGCCTGCCATCATCAGCTGG + Intergenic
1138370006 16:56519577-56519599 AAGACCCCACTGTCCTCTGCAGG + Intronic
1138598018 16:58039813-58039835 AAGGGCCTACTATCCTCTGCTGG - Intronic
1147988565 17:44320116-44320138 ACGGGCCTCCTTTCCACTGCAGG - Exonic
1148260163 17:46175158-46175180 TAGGGCCTACCATCCTGTGTTGG - Intronic
1203170393 17_GL000205v2_random:143298-143320 AATGGTCAACTGTCCTCTGCAGG + Intergenic
1154252676 18:12757311-12757333 AAGGCCCTGCCATCTTCTGCAGG - Intergenic
1163380343 19:16962133-16962155 AAGGAGCTACTATCCTTTGGAGG - Intronic
929955099 2:46451803-46451825 AAGCCCCCACTGTCCTCTGCTGG - Intronic
931597703 2:63967825-63967847 AAGGGCCAATTATCTTCTGTTGG + Intronic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
935680244 2:105629700-105629722 GAGGCCCTGCTTTCCTCTGCTGG + Intergenic
937342319 2:121099110-121099132 GAGGGCCTACTACCCTCTCTGGG + Intergenic
937493852 2:122397821-122397843 CAGGGCTTACTGTCCTCTCCTGG - Intergenic
941472296 2:165903122-165903144 AAGGGACAACTGTCCTCTGGGGG - Intronic
1173109569 20:40174106-40174128 AAGGGCCAGCTGTCCTTTGCAGG - Intergenic
1176326384 21:5505129-5505151 AATGGTCAACTGTCCTCTGCAGG + Intergenic
1176331329 21:5551073-5551095 AACGGCCAACTGTCCTCTGCAGG - Intergenic
1176396428 21:6269878-6269900 AACGGCCAACTGTCCTCTGCAGG + Intergenic
1176401373 21:6315822-6315844 AATGGTCAACTGTCCTCTGCAGG - Intergenic
1176435784 21:6673282-6673304 AATGGTCAACTGTCCTCTGCAGG + Intergenic
1176440729 21:6719226-6719248 AACGGCCAACTGTCCTCTGCAGG - Intergenic
1176460046 21:7000352-7000374 AATGGTCAACTGTCCTCTGCAGG + Intergenic
1176464991 21:7046295-7046317 AACGGCCAACTGTCCTCTGCAGG - Intergenic
1176483607 21:7382130-7382152 AATGGTCAACTGTCCTCTGCAGG + Intergenic
1176488552 21:7428073-7428095 AACGGCCAACTGTCCTCTGCAGG - Intergenic
1176623122 21:9071894-9071916 AAGGGCCTTCTATGGGCTGCTGG + Intergenic
1180507498 22:16027709-16027731 AAGAGCCTTCTGTCCTCTGCAGG - Intergenic
1181367441 22:22388978-22389000 AAGGCCCTGCCATCTTCTGCAGG - Intergenic
1181972795 22:26705227-26705249 CATGGAATACTATCCTCTGCAGG - Intergenic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
950154446 3:10711095-10711117 AAGTGGCCACTTTCCTCTGCAGG + Intergenic
954971323 3:54653925-54653947 AAGGGAATCCTCTCCTCTGCTGG + Intronic
957081124 3:75636590-75636612 AATGGCCAACTGTCCTCTGCAGG - Intergenic
957557734 3:81782357-81782379 GAGCGCCTATGATCCTCTGCTGG - Intergenic
960216468 3:115044198-115044220 AATGGCCTACTACACTCTCCAGG + Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961346912 3:126268896-126268918 AAGCACCTACTCTGCTCTGCAGG - Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
965316343 3:167195250-167195272 AAAGGCCTACAATTCTCTGATGG + Intergenic
965375734 3:167921425-167921447 AAGTGCCTGCTATCCTGTTCTGG - Intergenic
965598340 3:170430185-170430207 AAGGGACTAAAATCCTCTTCTGG - Intronic
965856074 3:173089533-173089555 AAGGGCCCATTAGCTTCTGCGGG + Intronic
971615935 4:28790704-28790726 AAGAGCCTCCTATCCTCCTCAGG - Intergenic
971979300 4:33732908-33732930 AAGGCCCTGCCATCTTCTGCAGG - Intergenic
973031707 4:45350567-45350589 AAGGAACTAATATTCTCTGCTGG - Intergenic
976730406 4:88255483-88255505 AGAGGCCCACTGTCCTCTGCAGG - Intergenic
980417996 4:132518642-132518664 AAGGACCTTGTATCCTCTTCTGG - Intergenic
983865514 4:172760795-172760817 GAGGTCCTCCTATCCCCTGCTGG - Intronic
985449768 4:190054524-190054546 AATGGCCAACTGTCCTCTGCAGG + Intergenic
989258248 5:39390038-39390060 AACGCCTTACTACCCTCTGCTGG + Intronic
989773039 5:45167814-45167836 AAGGGTCTACTGTCATCTGATGG + Intergenic
991478266 5:67047317-67047339 ATGGCTCTACCATCCTCTGCTGG + Intronic
996573979 5:124962459-124962481 AAGGGCCTACTGTCTTCTCATGG + Intergenic
1001300738 5:170531823-170531845 AGGGGCCTACTTTCCTTTGCTGG - Intronic
1006249879 6:32773972-32773994 AAGGGCCCACTCTACTCTTCTGG + Intergenic
1009715664 6:67391558-67391580 AAGGGCCTTCTGTCCTCTGCAGG + Intergenic
1010980861 6:82366677-82366699 AAGAGCCTGCTAACGTCTGCAGG - Exonic
1017530989 6:155292094-155292116 AAGGGCCTCCAGTCCTCTTCAGG - Intronic
1020561786 7:9737330-9737352 AAGGGCTTGCTGTCTTCTGCTGG - Intergenic
1029870036 7:103680868-103680890 CAGGGCCTATTGACCTCTGCAGG - Intronic
1036588488 8:10147019-10147041 AAGGGCCACCTCGCCTCTGCCGG - Intronic
1037413880 8:18627366-18627388 AAGAGCAGAGTATCCTCTGCAGG - Intronic
1040776091 8:51044794-51044816 CAGGCCCTGCTATCCTCTCCAGG + Intergenic
1046517009 8:115275699-115275721 TAGAGCCTTCTGTCCTCTGCAGG - Intergenic
1051966459 9:22834542-22834564 AAGGTCCTGCCATCTTCTGCAGG + Intergenic
1052988926 9:34507191-34507213 AAGGGCCCACTGTACTCAGCTGG - Intronic
1060796521 9:126515823-126515845 CAGGGCCAACTGTCCTCTGCTGG + Intergenic
1061609350 9:131736177-131736199 AAGAGCCTCTTCTCCTCTGCAGG + Intronic
1203430773 Un_GL000195v1:89255-89277 AACGGCCAACTGTCCTCTGCAGG + Intergenic
1203435737 Un_GL000195v1:135378-135400 AACGGTCAACTGTCCTCTGCAGG - Intergenic
1190929753 X:54937176-54937198 AAGGCCCTACTATCACCTGATGG + Intronic
1192673258 X:73168453-73168475 AAGGCCCTGCCATCTTCTGCAGG - Intergenic
1201284425 Y:12367206-12367228 AAGGGCCCAGTATCCATTGCTGG - Intergenic
1201771154 Y:17618268-17618290 AATGACCGACTGTCCTCTGCAGG + Intergenic
1201830401 Y:18287718-18287740 AATGACCGACTGTCCTCTGCAGG - Intergenic