ID: 1138598325

View in Genome Browser
Species Human (GRCh38)
Location 16:58041206-58041228
Sequence GCCCCGAGGAGGGCTCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138598325_1138598331 -2 Left 1138598325 16:58041206-58041228 CCACACCGAGCCCTCCTCGGGGC 0: 1
1: 0
2: 0
3: 14
4: 218
Right 1138598331 16:58041227-58041249 GCTGGCAGCTCCTGCCGTGCTGG 0: 1
1: 0
2: 2
3: 20
4: 215
1138598325_1138598332 -1 Left 1138598325 16:58041206-58041228 CCACACCGAGCCCTCCTCGGGGC 0: 1
1: 0
2: 0
3: 14
4: 218
Right 1138598332 16:58041228-58041250 CTGGCAGCTCCTGCCGTGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 222
1138598325_1138598334 9 Left 1138598325 16:58041206-58041228 CCACACCGAGCCCTCCTCGGGGC 0: 1
1: 0
2: 0
3: 14
4: 218
Right 1138598334 16:58041238-58041260 CTGCCGTGCTGGGCACTTGACGG 0: 1
1: 0
2: 1
3: 8
4: 135
1138598325_1138598335 10 Left 1138598325 16:58041206-58041228 CCACACCGAGCCCTCCTCGGGGC 0: 1
1: 0
2: 0
3: 14
4: 218
Right 1138598335 16:58041239-58041261 TGCCGTGCTGGGCACTTGACGGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138598325 Original CRISPR GCCCCGAGGAGGGCTCGGTG TGG (reversed) Intronic
900122585 1:1055159-1055181 GCAGCGTGGAGGGCTCGGCGTGG + Exonic
900242067 1:1621877-1621899 CCCCCGAGCAAGGCCCGGTGAGG - Intronic
900314763 1:2051166-2051188 GCCCCCGGCAGGGCTCGGGGCGG + Intronic
900422399 1:2561214-2561236 GCCCCAGGGAGGGGGCGGTGGGG + Intronic
900507567 1:3037318-3037340 TGCCCGAGGAGTGCTCGCTGGGG + Intergenic
901007575 1:6179475-6179497 GCCGCGGGGCGGGCTGGGTGGGG - Intronic
901799220 1:11697799-11697821 GACCCGTGGAGGGGTAGGTGGGG + Intronic
902514108 1:16980644-16980666 GCCCGGAGGGGGACTCGGAGCGG - Exonic
902698211 1:18154587-18154609 GCCCAGGGCAGGGCTGGGTGAGG + Intronic
903217531 1:21851653-21851675 GCGAGGAGGAGGGCTCGATGCGG + Exonic
903769522 1:25755055-25755077 GCCCCCGGCAGGGCTCGCTGTGG + Intronic
904030809 1:27532400-27532422 GCCCAGAGGAGGTTTCGGGGAGG - Intergenic
904942898 1:34177346-34177368 GCCACGCGGAGGACTGGGTGCGG - Intronic
906520916 1:46466512-46466534 GGCCCGAGGAGGGCGGGGCGGGG - Intergenic
907306017 1:53513583-53513605 GCCCAGAGGAGAGCCCAGTGGGG - Intronic
907315450 1:53567973-53567995 GGCCCAAGGGGGGCTCTGTGTGG - Intronic
915122853 1:153642362-153642384 GCCCAGAGGAGGACTACGTGGGG + Exonic
915836571 1:159181508-159181530 GCACGGGGGAGGGCTCAGTGAGG - Intronic
916719975 1:167477464-167477486 GCCCACAGGAGGGATCAGTGAGG - Intronic
918332056 1:183471200-183471222 GCCGCGAGGAGGCCAGGGTGAGG - Intergenic
918497349 1:185156266-185156288 GCCTCGAGGATGTCACGGTGAGG - Intronic
921496854 1:215853023-215853045 GCCCCAATGAGGACTCAGTGTGG + Intronic
1067069835 10:43123608-43123630 GCCCCCCGGAGGGCTCTGTGAGG + Intronic
1069724347 10:70567606-70567628 GCCCCAAGGAGTGCTAGCTGAGG + Exonic
1069785580 10:70985949-70985971 GGCCAGAGCAGGGCTGGGTGGGG + Intergenic
1070637658 10:78142160-78142182 GCCCCGGTGGGGGCTCTGTGTGG - Intergenic
1070698242 10:78579002-78579024 GCCACGAGGATGGCTGCGTGGGG + Intergenic
1070834669 10:79440748-79440770 ACCCAGAGGAGGGCTCCGGGAGG - Intronic
1070913228 10:80136145-80136167 CCCCAGAGGAGGGCTCGGCTGGG - Intronic
1075083169 10:119397257-119397279 GCCCCGAGGTGGGGTCGGGGTGG - Intronic
1075753331 10:124791652-124791674 GCCCCGAGAAGGGGACGGCGGGG - Intronic
1076170823 10:128318501-128318523 GCCCTGAGAAGGACTCTGTGTGG - Intergenic
1076611597 10:131729386-131729408 GCCCCCAGGAAGGATCGCTGAGG - Intergenic
1077147099 11:1051222-1051244 GCCCGGAGGAGGGCTGGGCAAGG - Intergenic
1077152121 11:1077163-1077185 GCCCCGAGGAGGGAGTGGAGAGG + Intergenic
1077402989 11:2368177-2368199 TCCCTGAGGAGGGATGGGTGAGG - Intergenic
1077479615 11:2807558-2807580 GGCCCGAGGAGGGCCCGGCCCGG - Intronic
1078434431 11:11312744-11312766 GCTGCTAGGAGGGCTCTGTGAGG + Intronic
1080774203 11:35370664-35370686 GCAGAGAGGAGGGCTCAGTGCGG + Intronic
1081349091 11:42026829-42026851 GCCCCAATGAGGACTCTGTGTGG + Intergenic
1082821370 11:57546464-57546486 GCACAGAGGAGGCCTCAGTGAGG - Intronic
1083945670 11:65921271-65921293 CCCCTGTGGAGGGCACGGTGGGG + Intronic
1084547211 11:69820407-69820429 CCCCAGAGGAGGGCACGCTGTGG + Intergenic
1091386695 12:100546-100568 GCTCTGAGGAGGACTCGGAGAGG + Intronic
1091927896 12:4370538-4370560 GCGCCGAGGACGACTCGGAGCGG - Exonic
1092155439 12:6278929-6278951 GCTCCGAGGAGGGCGCGGACGGG - Intergenic
1096242375 12:49966260-49966282 GCCCAGAGGAGAGGACGGTGGGG - Intergenic
1104969704 12:132525673-132525695 GCCCCGATGCGGACGCGGTGAGG + Intronic
1110596579 13:77326727-77326749 GCCCCGAGGAGGCGGCGGCGGGG + Intronic
1112756899 13:102645846-102645868 GCCAGGAGGAGGGCTGAGTGTGG + Intronic
1113029360 13:105976571-105976593 GCCCCAATGCGGGCTCTGTGTGG + Intergenic
1116098876 14:40408270-40408292 GCCCCAGTGAGGGCTCTGTGTGG + Intergenic
1117723194 14:58646691-58646713 GCCCTGAGGAGGGCCCGGCGCGG + Exonic
1118377863 14:65192472-65192494 GGCCTGAGGAGGCCTCTGTGAGG - Intergenic
1121199617 14:92106440-92106462 GCCTCTCGGAGGGCTGGGTGGGG - Intronic
1122284975 14:100645633-100645655 CCCCCGACCAGGGCTCAGTGGGG + Intergenic
1122959505 14:105088048-105088070 GCCCGCAGGCAGGCTCGGTGAGG - Intergenic
1123058229 14:105582398-105582420 GGCCCCAGGAGGACTTGGTGGGG - Intergenic
1123477390 15:20599281-20599303 GCCCCCAGGAGCCCTTGGTGAGG - Intergenic
1123640626 15:22401101-22401123 GCCCCCAGGAGCCCTTGGTGAGG + Intergenic
1124663203 15:31568059-31568081 GCCCCCATGAGGACTCTGTGTGG - Intronic
1127004137 15:54546318-54546340 GCCGGGTGGAGGGCTGGGTGAGG + Intronic
1129243791 15:74267840-74267862 GCCCGGAGGAGGGATGGGGGAGG - Intronic
1132167817 15:99613451-99613473 GGCCCTAGGAGGGGTGGGTGCGG - Intronic
1132318981 15:100910980-100911002 GCACAGAGCAGGGCTTGGTGAGG + Intronic
1132954739 16:2585636-2585658 ACCCCGTGGAGGGGTCGGCGTGG + Intronic
1133039569 16:3053118-3053140 GCCCTGTGGAGGGCTTGGTAAGG + Intronic
1133043412 16:3072751-3072773 GCCCTGTGGAGGGCTTGGTAAGG + Intronic
1133431373 16:5739974-5739996 GCCCTGGGGAGGGATCAGTGTGG + Intergenic
1135958040 16:26972620-26972642 GTCCCATGGAGGTCTCGGTGGGG - Intergenic
1136383289 16:29907017-29907039 GCCTCCAGGAGGGCTGGGTCTGG + Exonic
1138598325 16:58041206-58041228 GCCCCGAGGAGGGCTCGGTGTGG - Intronic
1141424093 16:83934405-83934427 GCCCCGAGGGGGGCTGGGGCTGG - Intronic
1141673142 16:85503308-85503330 GCCCCCAGGAGGGAAGGGTGTGG + Intergenic
1141957879 16:87384384-87384406 GCCCCGGGGAGGGCTTGGAGGGG + Intronic
1142377051 16:89711728-89711750 GCCCGTGGGAGGGCCCGGTGAGG - Intronic
1142966619 17:3585762-3585784 GGCCCGTGGATGGCTTGGTGCGG - Exonic
1143130235 17:4672984-4673006 GCCCGGAGGATGGAACGGTGGGG + Exonic
1143378362 17:6480421-6480443 GCTCTGAGGAGGGCTCAGTGCGG - Intronic
1146666958 17:34711652-34711674 GCCCTGAGGAGGGCTGTTTGTGG + Intergenic
1147114979 17:38292369-38292391 AGCCCGAAGAGGGCTGGGTGTGG - Intergenic
1147324890 17:39665457-39665479 GGCCCGAGGAGGGGTGAGTGTGG + Exonic
1147927840 17:43956212-43956234 GCCCCTAGGTGGTCTCAGTGTGG + Intronic
1148232914 17:45948293-45948315 GAGCCCAGGAGGGCTGGGTGCGG - Intronic
1148324869 17:46777353-46777375 GCCCCTTGGAGAGCTGGGTGAGG - Intronic
1148414638 17:47496841-47496863 AGCCCGAAGAGGGCTGGGTGTGG + Intergenic
1151625139 17:75271474-75271496 GCTCCGGGGAGGGCTGGGTGCGG - Intergenic
1151670410 17:75568977-75568999 GGCACGAGGACGGCACGGTGCGG + Exonic
1151971141 17:77458071-77458093 GCCCTCAGAAGGGCTCGCTGGGG - Intronic
1152354047 17:79798118-79798140 GCCCCGAGCAGGGGGCGGCGAGG - Intronic
1152728884 17:81960436-81960458 GCCCCGAGGAGTGCCCGGTTCGG - Intronic
1156452449 18:37274531-37274553 GCCCCGAGGAGCGGGCGGGGTGG - Intronic
1160500351 18:79398575-79398597 TCCCAGAGAAGGGGTCGGTGGGG - Intronic
1160846009 19:1166251-1166273 GCCCAGAGGGAGGCCCGGTGAGG + Intronic
1160889677 19:1370711-1370733 GCCCCGAGGAGCCCGTGGTGGGG + Exonic
1160951885 19:1671824-1671846 GGCCGGGGGAGGGCGCGGTGGGG - Intergenic
1161025006 19:2032665-2032687 GCCCTGAGGATGGCCGGGTGGGG + Intronic
1161399114 19:4059764-4059786 GCCTCCAGGAGGCCTAGGTGGGG - Intronic
1161512534 19:4679563-4679585 GCCCGGAGCAGGGGTGGGTGTGG + Intronic
1162777845 19:12990438-12990460 GCCCCGTGGGGGGCTGGGAGCGG - Intergenic
1163547480 19:17948517-17948539 GTGCCGAGGAGGGGGCGGTGGGG + Intergenic
1163779863 19:19240464-19240486 GCCTGGAGGTGGGCTGGGTGGGG - Intronic
1164834803 19:31350010-31350032 GCCCCGGGACGGGCTCGGCGGGG - Intergenic
1165357376 19:35312340-35312362 GCCCAGAGGAGGGCACACTGAGG - Intronic
1165803125 19:38565155-38565177 GCGCGGAGGAGGGCGCGGCGGGG + Exonic
1166599054 19:44077879-44077901 CCCCCGAGGAGGGGTCAGGGAGG - Intronic
925626179 2:5843828-5843850 GTGCAGAGGAGGGCTGGGTGCGG + Intergenic
927660784 2:24991137-24991159 GCCCCGGTGGGGACTCGGTGTGG - Intergenic
927870353 2:26619234-26619256 CCCCCGGGGAGGGCCCTGTGGGG - Intronic
931283695 2:60815387-60815409 GCCCCGAGTATGGCTGGCTGTGG - Intergenic
932112176 2:69011818-69011840 GCCCCAAGGAGGGGTCCGTGTGG - Intergenic
934734959 2:96685514-96685536 TCCCCGAGGAGGGCGGGGGGAGG - Intergenic
934777735 2:96949807-96949829 GCCCAGAGCAGAGCTCTGTGGGG + Intronic
934966734 2:98730740-98730762 ACCCCGAGGGGTGCGCGGTGCGG + Intronic
937151991 2:119692408-119692430 GGCCCGAGGAGGGAGCCGTGAGG + Intergenic
938583694 2:132669789-132669811 GCCCCGAGGTGGGCGCCTTGGGG + Intronic
941911713 2:170770868-170770890 GCGGCGAGGAGGGCCCGGGGCGG - Intergenic
944808905 2:203308877-203308899 GCCCCAATGAGGACTCTGTGTGG - Intergenic
946188602 2:217995648-217995670 GCCCCGGGGTGTGCTCCGTGAGG - Intronic
946404094 2:219483622-219483644 GGCCCGGGGAGGCCTGGGTGAGG + Exonic
947718019 2:232351535-232351557 GGGACGAGGAGGGCTCGGCGGGG + Intergenic
1171494885 20:25548684-25548706 GCCCCGGGTGGGGCTGGGTGTGG - Intronic
1174480544 20:50828271-50828293 GACCAGAGGAGGGCTAGGCGTGG + Intronic
1175429117 20:58890290-58890312 GCGCCGAGGAGGGCGCCGTCGGG + Intronic
1175926951 20:62475785-62475807 TCCCCGGGGTGAGCTCGGTGGGG + Intronic
1176010064 20:62888468-62888490 GCCCCCAGAAGTGCTGGGTGAGG - Intronic
1176094808 20:63335669-63335691 GCGCCGTGTAGGGCTCGATGTGG + Intergenic
1176138019 20:63533520-63533542 GCCCCGATCAGGGCTCTGTGTGG - Intronic
1176205497 20:63885935-63885957 TCCCCGAGGAGGGCTGTGAGTGG + Intronic
1178103923 21:29298616-29298638 GCCTCGAGGAGGCGGCGGTGGGG - Intronic
1178114903 21:29407156-29407178 TCCCCGAGGAGTCCTGGGTGGGG + Intronic
1179501991 21:41815871-41815893 GCCCCCAGGTGGGCTGCGTGGGG - Intronic
1179802429 21:43817233-43817255 GCCCAGAGGAGGCCTTTGTGTGG - Intergenic
1179809954 21:43864600-43864622 GCCGCGCGGCGGGCTCGGTGGGG - Intergenic
1180157577 21:45985647-45985669 GCCTCGTGAAGGGCTGGGTGTGG - Intronic
1180600056 22:17009666-17009688 GCCCCGAGGGGAGGTTGGTGAGG + Intergenic
1180782411 22:18528666-18528688 GCCACAAGGAGGACTTGGTGAGG + Exonic
1180952611 22:19727446-19727468 GACCCGATGAGGGCGCTGTGGGG + Intergenic
1181125962 22:20702693-20702715 GCCACAAGGAGGACTTGGTGAGG + Intergenic
1181335321 22:22124546-22124568 GCCCCAGGGAGGGTTGGGTGTGG + Intergenic
1182301109 22:29337676-29337698 GCACTGAGGAGAGCTCAGTGTGG - Intronic
1182792422 22:32964028-32964050 GCCCTGAGGTGGGCTGGGTGGGG + Intronic
1182837002 22:33350444-33350466 CCCCCGAGGAGGACACTGTGGGG - Intronic
1183409179 22:37644991-37645013 GCCCCGAGCAGGGCAGGGTCAGG - Intronic
1183432888 22:37776144-37776166 GCCCTGAGGAGGGATGGGAGGGG - Exonic
1183516633 22:38270644-38270666 GCCCCTGGGAGAGCTCTGTGTGG - Intronic
1184424996 22:44404076-44404098 GCCCTGAGGAGAGCTGGGTCTGG + Intergenic
954215199 3:49120768-49120790 GGCCCGAAGAGGGCTGGCTGCGG - Exonic
954439037 3:50511576-50511598 GCCCCCAGGTGGGCTAGCTGAGG + Intergenic
956744345 3:72299755-72299777 GCACTGAGGAGCACTCGGTGAGG - Intergenic
960469635 3:118046600-118046622 GCCGGGAGGAGGGGTGGGTGGGG + Intergenic
961950713 3:130746675-130746697 CCCTCGAGGAGGGCTCGGACGGG - Exonic
966853938 3:184181260-184181282 GTCCCTTGGAGGGCTCAGTGGGG + Intronic
966910247 3:184555594-184555616 GCCCCGAGGAGGCCTCCTTTGGG + Intronic
967188029 3:186961912-186961934 TCCCCCAGGAGGGCTCCTTGTGG + Intronic
968025914 3:195442612-195442634 CCCCTCGGGAGGGCTCGGTGGGG + Intronic
968292528 3:197549632-197549654 CCCCCGAGGAGGGCAAGCTGGGG + Intronic
968523746 4:1046118-1046140 GGCTCGGGGAAGGCTCGGTGAGG - Intergenic
968523756 4:1046151-1046173 GGCTCGGGGAGGGCTCGGGGAGG - Intergenic
968523777 4:1046195-1046217 GGCTCGGGGAGGGCTCGGGGAGG - Intergenic
968523852 4:1046378-1046400 GGCTCGGGGAGGGCTCGGGGAGG - Intergenic
968951805 4:3699380-3699402 GCCCCCAGGAGGGGTCTGTCTGG - Intergenic
969053180 4:4386814-4386836 GCCCCCAGGGGGTCTCGGAGCGG - Exonic
969650641 4:8465841-8465863 GCCCAGAGGAGGCCTCAGTGTGG + Intronic
970449609 4:16154087-16154109 GCCCTGAGGAGGGGACAGTGGGG - Intergenic
972333843 4:38087893-38087915 GCCCCGCTGAGGGTTAGGTGGGG - Intronic
973293407 4:48490956-48490978 GCCCAGAGGAGGGGGAGGTGTGG + Exonic
975038118 4:69710024-69710046 CCCCCAAGTAGGGCTCTGTGTGG + Intergenic
976356720 4:84127202-84127224 GGCCCCAGGAGGGCTGGGGGAGG + Intergenic
976524927 4:86075982-86076004 GGCCCCAGGAGGGCTGGGGGAGG - Intronic
977660456 4:99579397-99579419 GCCCCGAGGAGGGCTCCTGCAGG - Intronic
981862931 4:149379235-149379257 GCCCCAATGAGGACTCTGTGTGG - Intergenic
983008466 4:162515766-162515788 GCCCAGAGGAGGGCTGGTGGGGG + Intergenic
985980301 5:3456998-3457020 GCCCCTCGGAGGGCTTGCTGGGG - Intergenic
986404955 5:7416355-7416377 GCCCCTTGGAGGGCTGGGCGCGG + Intronic
988170762 5:27652525-27652547 GCCCCGGTGAGGACTCTGTGTGG - Intergenic
1002455011 5:179341093-179341115 TCCCCGACCAGGGCTCTGTGAGG + Intronic
1002797865 6:489936-489958 GCTCCCGGGAGGGCGCGGTGGGG + Intronic
1002836047 6:865952-865974 GCCCAGAGGAGGGCAGGGAGAGG - Intergenic
1008881773 6:56387559-56387581 GCACTGAGGAGGGCTGGGAGAGG - Intronic
1018812231 6:167306608-167306630 GCCCCAGGCAGGGCTGGGTGTGG + Intronic
1019597243 7:1863796-1863818 GCCCCGAGGAAGGCCAGGCGCGG + Intronic
1019983939 7:4641761-4641783 GCCGCGAGCAGGGCCCGGGGCGG - Intergenic
1020869333 7:13607813-13607835 GCCCCAATGAGGACTCTGTGTGG - Intergenic
1022045769 7:26621061-26621083 TCCCCGTGCAGGGCTCTGTGGGG + Intergenic
1022127887 7:27375593-27375615 GACACTAGGAGGGCTCTGTGGGG - Intergenic
1025175895 7:56802338-56802360 GCCCTGAGTAGGCCACGGTGAGG + Intergenic
1025177879 7:56811086-56811108 GGCCCGAGGAGGCCACGGCGAGG + Intergenic
1025690340 7:63750733-63750755 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025690789 7:63752556-63752578 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025691229 7:63754331-63754353 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025691670 7:63756155-63756177 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025692114 7:63757978-63758000 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025692562 7:63759801-63759823 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025692977 7:63761480-63761502 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025693422 7:63763303-63763325 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025693867 7:63765142-63765164 GGCCCGAGGAGGCCACGGCGAGG - Intergenic
1025695898 7:63774084-63774106 GCCCTGAGTAGGCCACGGTGAGG - Intergenic
1027390321 7:77697048-77697070 GCCCCGAGGTGGGTGCCGTGCGG + Exonic
1029086754 7:98018028-98018050 GCCCAGAGTAGGGGTCAGTGTGG - Intergenic
1029359959 7:100081510-100081532 GCCCGGAGCAGGGTTCGGGGAGG - Intronic
1029547332 7:101217259-101217281 GCCCCGAGGAGGTCATGGTGGGG + Exonic
1031254934 7:119435412-119435434 GCCCCAATGAGGACTCTGTGTGG + Intergenic
1031886842 7:127252802-127252824 TCCCCGCAGAGGGCGCGGTGAGG + Exonic
1033560848 7:142528940-142528962 GCCCCCTGGAGGGCTGAGTGGGG + Intergenic
1034306579 7:150048762-150048784 GCCACCAGGAGGGCGCGGGGTGG + Intergenic
1034441163 7:151086703-151086725 GGCCCGAGGCGGGCCCGGGGCGG - Intronic
1034539276 7:151745816-151745838 CCCCCATGGAGGGCTCGGTGGGG + Intronic
1034800267 7:154051881-154051903 GCCACCAGGAGGGCGCGGGGTGG - Intronic
1034948319 7:155278991-155279013 ACCCAGGGGAGGGCTCTGTGCGG - Intergenic
1035553135 8:544989-545011 GTCCTGAGGAGGGCTTGGAGCGG - Intronic
1037858759 8:22389921-22389943 ACCCAGAGGAGGGCACTGTGAGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038411471 8:27362631-27362653 GCCCCAAGGAAGTCTTGGTGGGG - Intronic
1039979096 8:42391675-42391697 GTGCGCAGGAGGGCTCGGTGTGG - Intronic
1040549974 8:48430169-48430191 GCCCCAGGGAGGGGTCTGTGGGG + Intergenic
1040951063 8:52939626-52939648 GTCCCGAGGAGGGGTGGGGGTGG - Exonic
1045098749 8:98825389-98825411 GCCCCGAGCCGGGCGCGCTGAGG - Intronic
1049383166 8:142327547-142327569 GCCCGATGGAGGGCTCTGTGAGG - Intronic
1049476576 8:142799718-142799740 GCCCCGTGGAGGGCCTGCTGTGG - Intergenic
1049532648 8:143162152-143162174 GCTCCCCGGAGGGCTCTGTGTGG - Intergenic
1049804950 8:144534508-144534530 GCCCCGGGGAGGGAGCAGTGGGG - Intronic
1056797652 9:89669771-89669793 GCCCCCAGGAAGGTTGGGTGGGG + Intergenic
1060155824 9:121319077-121319099 GCCCCGAGGAGTGCCTGGTCTGG + Intronic
1061086880 9:128404759-128404781 ACCCCGAGGGGGGTTGGGTGGGG + Intergenic
1061945036 9:133903820-133903842 GACCCGGAGAGGGCTCGGGGAGG + Intronic
1062577232 9:137214428-137214450 GGACCGAGGAGGGCAAGGTGAGG + Intronic
1062716149 9:138011185-138011207 GCACCAAGGAGAGCTCTGTGGGG - Intronic
1186830108 X:13381629-13381651 GCCCCTAGGAAGGCAGGGTGTGG + Intergenic
1187915581 X:24149924-24149946 GCCCCGAGGAGGCCGCAGTTAGG + Intronic
1195390579 X:104358048-104358070 TCCCCGAGGAGTGCTGGGTTGGG + Intergenic
1198254677 X:134914788-134914810 GCACCGAGGACGGCTGGGGGAGG - Intronic
1200418291 Y:2935576-2935598 GCCCCGAGGAGGCCGCAGTTAGG + Exonic