ID: 1138599243

View in Genome Browser
Species Human (GRCh38)
Location 16:58045335-58045357
Sequence GCTGCTGCTGCTCTGCGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 8, 3: 57, 4: 483}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138599243 Original CRISPR GCTGCTGCTGCTCTGCGTCC TGG Exonic
900355471 1:2260142-2260164 GTTCCTGCTGCTCCACGTCCTGG + Intronic
900554235 1:3271794-3271816 CCTGCTGCTGCTTTCCGTGCTGG - Intronic
900565747 1:3331116-3331138 GCTGCTCCTGCCCTTCGGCCTGG + Intronic
900642168 1:3692914-3692936 GCTGCTGCTGCCCGGTGCCCTGG + Intronic
900694213 1:4000109-4000131 GCTGCAGCTGCTCTGAGTCCAGG + Intergenic
900726294 1:4218553-4218575 GCTGGTGTTGCTCTGCTTGCGGG - Intergenic
900787669 1:4658863-4658885 GCCGGCGCTGCTCTGCCTCCAGG - Intronic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
901316741 1:8314903-8314925 GCAGCTTCAGCTCTGCATCCAGG + Intergenic
901569362 1:10147052-10147074 TCAGCTGCTGCTCCGCATCCTGG + Exonic
901790375 1:11650679-11650701 GCCGCTGCTGCTGCGCGTGCTGG - Exonic
901791560 1:11655910-11655932 GCTGCTGCTGAACTGCCGCCTGG + Exonic
901793793 1:11668754-11668776 GCTGCTGCTGAACTGCCGCCTGG + Exonic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
902044506 1:13514431-13514453 GCTGCTGAGGCTCTGAGGCCTGG + Intergenic
902314152 1:15604902-15604924 GCTGCTGCTGCTGTGCCGGCTGG - Intergenic
902447363 1:16475875-16475897 GCTGCTGCTCCACTGCCTCCTGG + Intergenic
902507368 1:16946919-16946941 GCTGCTGCTCCAATGCCTCCTGG - Exonic
902744842 1:18466911-18466933 ACTGCAGCTGCACTGGGTCCAGG + Intergenic
903036568 1:20496766-20496788 GCAGCTGCTGCTCCGCTTCTGGG - Intergenic
903743772 1:25573415-25573437 GCTGCTGCTCCTGTAGGTCCCGG + Intergenic
903788364 1:25875807-25875829 GCGGCTGCAGCTCTGCGCCGAGG - Intergenic
904576960 1:31511099-31511121 ACTGATTCTGCTCTGCCTCCAGG - Intergenic
905381006 1:37561600-37561622 GCTGCTGCTGCTGCGAGTCCGGG + Exonic
905569351 1:38991500-38991522 GCGGCGGCGGCTCGGCGTCCGGG - Exonic
905664277 1:39753172-39753194 GCTGCTGCTGCCCAGGTTCCGGG + Intronic
905959877 1:42035250-42035272 GCTGCTGCTGCAGGGCGCCCGGG - Intronic
906047895 1:42846752-42846774 GATGCTGCTGCTTTGCTCCCTGG + Intronic
906402483 1:45515184-45515206 GCTGCTTCTTCTCTGCTGCCAGG + Intronic
906529219 1:46513611-46513633 CCTGCTGCTGCTCTCCATCCAGG - Exonic
908718060 1:67091076-67091098 GCTGCTGCTGCTCTCCAGCCTGG + Intergenic
908799397 1:67863995-67864017 GGTGATGGTGCTCTGCTTCCTGG + Intergenic
910180670 1:84479292-84479314 GCTGCTGCTGCTCTTATCCCCGG - Exonic
910679074 1:89843938-89843960 GCTGCTGCCGCCCTGGGTTCGGG + Intronic
911149147 1:94580329-94580351 ACTGATGCTGCTCAGCCTCCTGG + Intergenic
911664719 1:100539584-100539606 TCTGCTGCTGCACTGCTACCTGG + Exonic
912270086 1:108200072-108200094 GCGTCGGCTGCTCCGCGTCCTGG + Exonic
912491995 1:110067579-110067601 CCTGCTGCGGCGCTGCTTCCTGG - Intronic
914950595 1:152110405-152110427 GCTGCAGCTGCTCTTCCTCGCGG + Exonic
914950864 1:152112325-152112347 GCTGCTGCTGCTCTTCCTCCTGG + Exonic
915320012 1:155051392-155051414 GCTGGCGCTGCTCTGGGCCCTGG + Exonic
915343238 1:155187487-155187509 GCTGGTGCTGGTCTGTGTTCTGG - Exonic
915548565 1:156618224-156618246 GCTACCTCTGCTCTGCCTCCCGG - Intergenic
916155386 1:161840389-161840411 GCTGCTGCTGCTCTGTGGCTTGG - Intronic
916202817 1:162287945-162287967 ACTGCTGCTGCTCCGTGTGCAGG + Intronic
916482327 1:165225763-165225785 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
916691592 1:167195107-167195129 GCTGCTTCTGCTCAACTTCCTGG - Intergenic
918326344 1:183414216-183414238 CCTGCTGCTGCTCTACAGCCTGG + Intronic
918708926 1:187703702-187703724 CCTGCTGCTGCTCCGAGTGCGGG - Intergenic
919007716 1:191921291-191921313 GGTGCTGCGGCTGTTCGTCCAGG - Intergenic
919754815 1:201060034-201060056 GCTGATGATCCTCTGCGACCTGG + Intronic
920178328 1:204117118-204117140 GCTGCTGCTGCTTTGCAATCTGG - Exonic
920960273 1:210657273-210657295 GCAGCTGCTGCTCTTCATCCAGG - Intronic
921692279 1:218164962-218164984 GCTGGGGCCGCTCTGGGTCCCGG - Intergenic
922180230 1:223227637-223227659 GGTGCTGCTGCTCGTCATCCTGG - Exonic
922466579 1:225848956-225848978 GGTGCTGCTGCTCACCATCCTGG - Exonic
922804118 1:228376973-228376995 GCTCCTGCTGCTCTGAGTGTTGG + Intronic
923097533 1:230787545-230787567 GCTGCTCCTCCTCTGTCTCCTGG - Exonic
923141313 1:231163083-231163105 GCAGGTGCTGCTCACCGTCCGGG - Exonic
924511276 1:244730762-244730784 GCGGCTCCTGCTCTGGGTGCTGG - Intergenic
924527423 1:244864380-244864402 GCTGCGGCTGCTCCTCGGCCCGG + Exonic
1063905398 10:10775660-10775682 GCCCCTGATGCTCTGCCTCCTGG - Intergenic
1064000642 10:11661330-11661352 GCTGCTTCTGCTCTGCTTCCTGG - Intergenic
1064838692 10:19564042-19564064 GTTGCTGGTGCTGTGCTTCCTGG + Intronic
1065296812 10:24283756-24283778 GTTCCTGTTGCTCTGCATCCTGG + Intronic
1065453177 10:25879994-25880016 GCTGATGCTGCTCTCTGGCCTGG - Intergenic
1066451410 10:35533451-35533473 GCTGCAGCTGCTCTGTTCCCTGG + Intronic
1067134820 10:43598647-43598669 GCTGCTGCTGCTGTGCTGGCCGG + Intergenic
1067177162 10:43958207-43958229 GCTGCTGCTCCTCTCCATTCAGG - Intergenic
1067225535 10:44373695-44373717 GATGCTGCTGCCCTGCATCCTGG + Intronic
1068538623 10:58267881-58267903 GCTGCTGCTGTTCTTCGGCTCGG - Exonic
1068953925 10:62805035-62805057 TCGGCTGCTCCTCTGCGTGCCGG - Exonic
1068954907 10:62813733-62813755 GCTGCTGCTGAGCTGCTACCAGG + Exonic
1069664596 10:70146163-70146185 GCTGCTGCTGCTGAGCTGCCCGG - Exonic
1069774331 10:70918037-70918059 GACTCTGCTGCTCTGCCTCCCGG + Intergenic
1069898234 10:71692072-71692094 GCTGCTGCTGCTCAGAGCCCTGG - Intronic
1069981335 10:72255037-72255059 GCTTCCTCTGCTCTGGGTCCTGG + Intergenic
1070167828 10:73911573-73911595 GCGCCTGCTTCTCTGCGTCCTGG + Exonic
1070587973 10:77780598-77780620 GCTGCTGCTGCTCTTCTCCATGG + Intergenic
1071525781 10:86357342-86357364 GCTGCTGCTGTTCCTAGTCCTGG - Intronic
1071991655 10:91105545-91105567 GCTGCTGCTCCTCTGAGTGGAGG - Intergenic
1072705765 10:97679791-97679813 TCTGCAGCAGCTCGGCGTCCTGG + Exonic
1073100546 10:101004103-101004125 GCTGCTGAAGCTCTGCCTCCCGG - Exonic
1074137937 10:110644195-110644217 GCGGGAGCTGCTCTGCGGCCGGG - Intergenic
1074578623 10:114694894-114694916 GCTGCTGCGGCTCAATGTCCGGG - Intergenic
1075454448 10:122576152-122576174 GCTCCTCCTGATCTGCATCCTGG - Intronic
1075710299 10:124527132-124527154 TCCGCTGCTGCTCTGCGGCTCGG + Intronic
1076065478 10:127444579-127444601 CCTCCTGCAGCTCTGCGTCCTGG - Intronic
1076126436 10:127977892-127977914 GCTGCAGCCACTCTGCTTCCAGG - Intronic
1076335847 10:129706026-129706048 ACTGCTGCAGCCCTGCGTCAGGG + Intronic
1076348043 10:129794151-129794173 GCGGCTGCTCCTCTGCCGCCAGG - Intergenic
1076981983 11:209415-209437 GGAGCTGCTGGTCTCCGTCCTGG + Exonic
1076992060 11:280547-280569 GCAGCGGCTGCTCTTCATCCTGG + Exonic
1077336444 11:2007033-2007055 CCTGCAGCTCCTCTGGGTCCTGG + Intergenic
1077592172 11:3500601-3500623 ACTGCTGCTGATCTCCTTCCAGG - Intergenic
1079721559 11:23820775-23820797 GCTTCTACTGCTATGCTTCCTGG + Intergenic
1080304945 11:30826056-30826078 GCTGCTGCTGCTCTGAGTCTGGG + Intergenic
1080556483 11:33421961-33421983 GCTGCTGCTGCTATTGGTCTGGG + Intergenic
1080614752 11:33936099-33936121 CCTGCAGCAGCTCTGCCTCCTGG + Intergenic
1081811283 11:45915531-45915553 GCTCCTGCTGCTCTGGTTCAAGG - Exonic
1083140178 11:60715047-60715069 GCTGCTGGTCTTCTGCCTCCTGG + Exonic
1083436553 11:62647238-62647260 TCTGCTGCTGCTCAGTGTCTGGG - Exonic
1083668479 11:64287823-64287845 CCTGCTGCTTGTCCGCGTCCTGG + Exonic
1083889917 11:65590581-65590603 GCTGCAGCTGCTGTGAGTGCTGG + Exonic
1083954651 11:65976739-65976761 GCTGCTGCTTCTCCTCGTCCAGG - Exonic
1083959420 11:66006347-66006369 GAGGCTGCTGGTCTGAGTCCCGG + Intergenic
1084171052 11:67401322-67401344 GCTGTTGCTGCTGAGCCTCCCGG + Intronic
1084248000 11:67873341-67873363 ACTGCTGCTGATCTCCTTCCAGG - Intergenic
1084468532 11:69341601-69341623 GGTGCTGCTGCTGTGGGTCCAGG - Intronic
1084546836 11:69818897-69818919 GCTGCTACTGCTCAGCCTGCTGG - Exonic
1084824812 11:71722151-71722173 ACTGCTGCTGATCTCCTTCCAGG + Intergenic
1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG + Exonic
1085345152 11:75763884-75763906 GCTGCTGCTGCTTTGTGGTCAGG - Intronic
1085353458 11:75815459-75815481 CCGGCCGCTGCTCTGCCTCCCGG + Exonic
1087399964 11:97652340-97652362 GCTGTTGCTGCTCAGCTCCCTGG + Intergenic
1089605321 11:119638217-119638239 GCTGCTGCCTCCCTGGGTCCAGG + Intronic
1089790134 11:120936867-120936889 CCTTCTGCTCCTCTGCCTCCTGG - Intronic
1090398166 11:126432662-126432684 ACTGCTGCTGCTCCGAGTCCTGG + Intronic
1091321832 11:134657314-134657336 GCTGCTGCTGCTCAAGCTCCGGG - Intergenic
1202819428 11_KI270721v1_random:62215-62237 CCTGCAGCTCCTCTGGGTCCTGG + Intergenic
1091676619 12:2495587-2495609 GCTGCTTCTGCTCCCCGCCCCGG - Intronic
1092109535 12:5949123-5949145 GCTCCTGCTGCTCTCCGACACGG - Exonic
1092214035 12:6667935-6667957 GCTGCTGCTGCTGTGATGCCTGG + Exonic
1093763840 12:22939979-22940001 GCTGCTGCTGCACTCCAGCCTGG - Intergenic
1093894758 12:24563127-24563149 TCAGCCGCTGCTCTGCGCCCAGG + Intergenic
1094203662 12:27817931-27817953 GCTGCTGTTGCCCTGTCTCCCGG - Intergenic
1095932073 12:47637160-47637182 GCTGCTGCTGCTGTGGGGGCTGG - Intergenic
1096701119 12:53383419-53383441 GCTGCTGCTGGTCTGCCCCAAGG - Exonic
1096804722 12:54133676-54133698 CCTGCAGCTTCTCTGGGTCCTGG - Intergenic
1098416879 12:70243868-70243890 GCTGCCGCCGCGCTGCTTCCTGG + Intronic
1098893343 12:76031480-76031502 GCGGCGGCGGCTCTGGGTCCCGG + Exonic
1099072353 12:78061064-78061086 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1100191997 12:92202951-92202973 GATTCTACTGCTCTGGGTCCAGG + Intergenic
1100580722 12:95937681-95937703 TCATCTGCTGCTCTGCTTCCGGG - Intronic
1101326549 12:103720841-103720863 TCTGCTGCAGGTCTGCTTCCTGG + Intronic
1101761793 12:107664747-107664769 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
1102491204 12:113290563-113290585 GCTGCAGCTGCACTGCCCCCTGG + Intronic
1103923000 12:124409231-124409253 CCTGCTCCTGCTCTGAGGCCAGG + Intronic
1104021252 12:124993853-124993875 GCTGCTGCTGCTCGGGCTGCTGG + Exonic
1104906342 12:132215454-132215476 GCTGCTTGTGCTCTCCGTCGAGG - Intronic
1105068121 12:133217453-133217475 GCTGCTTCTGCCCTGAGTCTGGG + Intergenic
1106021094 13:25916234-25916256 GCTCCTGCTGGTCTGTGGCCAGG + Intronic
1106265713 13:28107736-28107758 GCTGCTGCTGCTGTGCCAGCTGG - Intergenic
1106296889 13:28422644-28422666 GCTTCTGCTGATCTCCTTCCTGG - Intronic
1106453324 13:29904418-29904440 CCTGCTGCTGCTCTGTCTCTTGG + Intergenic
1109204317 13:59465049-59465071 CCTGCTGTTGCTCAGTGTCCTGG - Intergenic
1112006552 13:95258698-95258720 TCTGCTGCTGCTCTTCAGCCTGG - Intronic
1113200789 13:107866374-107866396 GCTGCTGGTGCTCCTTGTCCCGG + Exonic
1113540124 13:111100732-111100754 GCTGCTGCTGCGCTGAGTTCAGG - Intergenic
1114454417 14:22845928-22845950 GCTGCTGCTGCTCCTGGTGCTGG + Exonic
1114501577 14:23173231-23173253 GCAGCTTCTGCTCTGCGTGGTGG - Intronic
1114543787 14:23483450-23483472 GCTGCTGTTGCTCTGCAGGCAGG + Intronic
1116203480 14:41830761-41830783 GCTGCTCCTGCTCTGTCTCCTGG + Intronic
1116283706 14:42945231-42945253 GCTGCTGCTTCTCTCCTTCCGGG - Intergenic
1117690235 14:58298758-58298780 GCTGCTGCTGCCCGAGGTCCCGG + Intronic
1118348358 14:64956069-64956091 GATGCTGATGCTGTGGGTCCAGG - Intronic
1118436132 14:65772312-65772334 GCTGCTCCTCCTCTGTGGCCTGG + Intergenic
1118593420 14:67418577-67418599 GCTGCTCCTACTCTGGGTCCAGG + Intergenic
1118761238 14:68881409-68881431 GCTCCTGCTGTTCCGCCTCCTGG + Intronic
1118957527 14:70496918-70496940 GCTGTTGCTGCTCAGCCCCCTGG - Intergenic
1119199050 14:72739683-72739705 GCTGGTGCTGCTCCAAGTCCAGG + Intronic
1119234180 14:73005771-73005793 GCTGCTGCTGCTGTGCACCTGGG - Intronic
1119518395 14:75266593-75266615 GCAGCTGCTGCCATGCATCCTGG - Intronic
1119840711 14:77790775-77790797 GCTGCTGCTGCCCTTCCTGCTGG - Intergenic
1119948432 14:78719358-78719380 GCTGCTGCTCCTCTCCATTCGGG + Intronic
1120141039 14:80929914-80929936 TCACCTGCTGCTCTGCATCCCGG - Intronic
1120789167 14:88563294-88563316 GCTGCGGCTCCTCCTCGTCCAGG + Intronic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1122269152 14:100560596-100560618 ACTGCTGGTTCTCTGTGTCCTGG - Intronic
1122811211 14:104290255-104290277 GCTGCTGCTTCTCAGCCCCCAGG + Intergenic
1122819702 14:104335298-104335320 ACTCCTGCTCCTGTGCGTCCTGG - Intergenic
1122884338 14:104703917-104703939 GCTGCAGCTGCTGGACGTCCTGG + Exonic
1122969024 14:105144965-105144987 GCTGGTGTTGCTTTGCGACCGGG - Exonic
1122975264 14:105168354-105168376 GCTGCTGGCGCTCTGGGTGCAGG - Exonic
1124430641 15:29605091-29605113 GCTGAAGCTGCTCTGTTTCCTGG + Intergenic
1124500568 15:30224022-30224044 GATGCTGCTGCTCTGCCACTGGG + Intergenic
1124743005 15:32314645-32314667 GATGCTGCTGCTCTGCCACTGGG - Intergenic
1124786110 15:32682136-32682158 GCTGCTGCTGCTGGTGGTCCTGG - Intronic
1126850716 15:52795288-52795310 GCAGCTGCTGCTCTTGGGCCGGG - Intergenic
1127289365 15:57556674-57556696 GCTGCTGTTGCTATGGGTCATGG + Intergenic
1128052442 15:64675887-64675909 GCTGCTGCTGCTCTAAGCTCTGG - Exonic
1129034026 15:72639127-72639149 GTTGCAGCTGCTCTGCAGCCAGG + Intergenic
1129215856 15:74098089-74098111 GTTGCAGCTGCTCTGCAGCCAGG - Intergenic
1129408949 15:75338366-75338388 GTTGCGGCTGCTCTGCAGCCAGG + Exonic
1129613811 15:77082415-77082437 GCTGCTTCTGGTCTGTCTCCTGG - Intronic
1129732995 15:77942420-77942442 GTTGCGGCTGCTCTGCAGCCAGG - Intergenic
1129871582 15:78944948-78944970 GCTGCCGCTGCTCTGCGCCGGGG - Exonic
1130093418 15:80839492-80839514 GCTGCTGCTGCTGCGGGTGCTGG - Intronic
1130737772 15:86568645-86568667 GCTGCTGATGCTCTGCTCCAGGG - Intronic
1130871751 15:87977591-87977613 CCTGCTGATGCTTTGGGTCCAGG - Intronic
1130983112 15:88826494-88826516 CCTGCTGGGGCTCTGAGTCCTGG - Intronic
1131016044 15:89058560-89058582 GCTTCTCCTGCTCTGGGCCCAGG + Intergenic
1131466049 15:92655602-92655624 GCTGCTGCTGCTCGCGCTCCTGG - Exonic
1132053001 15:98625942-98625964 GCTGCAGCTGCACTGCAGCCTGG + Intergenic
1132285835 15:100661649-100661671 GCTGCTGCTACTGTGGGTCCTGG + Intergenic
1132512766 16:352500-352522 GCGGCTGCGGCTCGGCGGCCCGG + Exonic
1132906407 16:2284911-2284933 GCTGCTCCTGCTCTACGGCTGGG - Exonic
1132940902 16:2507633-2507655 TGCGCTGCTGCTGTGCGTCCAGG + Intronic
1133152822 16:3849760-3849782 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1133916299 16:10112633-10112655 GCTGCTGCTGCTCTTCTCCATGG - Intronic
1134018610 16:10906595-10906617 GCTGCTGCTCCTCTCCAGCCTGG - Exonic
1135182797 16:20290231-20290253 CCTGCTGCTGCACTGCAGCCTGG - Intergenic
1136235441 16:28910941-28910963 GCAGCAGCTGCTCTGAGTTCTGG + Exonic
1137403279 16:48170777-48170799 GCTGCTGCTGCTTCGGGTCATGG - Intronic
1138340210 16:56284294-56284316 GCTGATGCTGCACTGAGCCCTGG - Intronic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1139466047 16:67154765-67154787 GCTGCTGCGGCGCTTCGTGCAGG - Exonic
1139578695 16:67858848-67858870 GTTGCTGCTGCTCTGCCTTCAGG + Intronic
1139588902 16:67922205-67922227 TCTGCTGATGCTCTTCGTCGTGG + Intronic
1139849619 16:69942836-69942858 GCTGCTGCTGCTCTCCTGCTAGG + Intergenic
1139922913 16:70470958-70470980 GCTGCTGCTCCTGTGCAGCCAGG - Exonic
1140186160 16:72774220-72774242 GCTGCTGCTGCCCTGTGTTTCGG + Intergenic
1140378583 16:74465550-74465572 GCTGCTGCTGCTGCTCGTCTAGG + Intronic
1140474065 16:75229879-75229901 GCAGCTGCTGCTCTTCTACCTGG - Exonic
1140771318 16:78206507-78206529 GCTGATGCTGCTCTACTACCTGG + Intronic
1140972868 16:80030125-80030147 GCTGCTGATGCTGTGTGTCCAGG - Intergenic
1141454003 16:84126316-84126338 GCTGATGCTGCTCTGCTTCAGGG + Intronic
1141459858 16:84171712-84171734 GCGGCTGCTGCTTTGACTCCTGG + Intronic
1141831142 16:86510520-86510542 GCCGCCGCTGCTCTGCGCCGCGG - Exonic
1141962961 16:87421575-87421597 GCTGCTGCTTGTTTGCGACCTGG - Intronic
1142290167 16:89190467-89190489 TCTGCAGCTGCTCTGTGTCAGGG - Exonic
1142319554 16:89372173-89372195 GCTGCCGCTGCTTTTCCTCCTGG - Intronic
1142409847 16:89910454-89910476 GCTGCTGCTGCTCTGCCCCCTGG + Intronic
1142698372 17:1645652-1645674 GCTGCTGCTGCTCTGGACTCGGG - Exonic
1143502568 17:7347777-7347799 GCCGCAGCTGCCCTGCCTCCTGG + Intronic
1144778037 17:17794733-17794755 GCGGCTGCTGCTCAGCGCCCTGG + Exonic
1145294684 17:21578814-21578836 GATCCTGCTCCTCTGCCTCCTGG + Intergenic
1146214908 17:30971262-30971284 GCGGCTGCTGCGCGGCGCCCTGG - Exonic
1147053859 17:37818905-37818927 GCTGCTGCTGGTGTTGGTCCAGG + Intergenic
1147134759 17:38428457-38428479 GCAGCGGCGGCTCTGCGGCCGGG - Exonic
1147292014 17:39451148-39451170 ACTGCTGGTGCCCTGCGTCCCGG - Exonic
1147649581 17:42054266-42054288 GCTGGTCCTGCTCTGCCTGCTGG + Intronic
1147970870 17:44218785-44218807 GCGGCGGCTGCGCTGCGTCCGGG - Intronic
1147998428 17:44374371-44374393 CCTGCTGCTGCTCACCATCCTGG - Exonic
1148062027 17:44843129-44843151 CCTGCTGCTCCTCTTCCTCCAGG - Intergenic
1148110998 17:45144579-45144601 GCTGCTCCAGCTCCGCGCCCCGG + Intergenic
1148189592 17:45669258-45669280 GCTGCTGCTGCTGTGAGTTTTGG + Intergenic
1148214929 17:45829355-45829377 CCTGCTTCTGCTCTAGGTCCTGG - Intronic
1148218940 17:45849128-45849150 CCTGCTGCTGGCCTGCGTCACGG + Intergenic
1148714698 17:49707776-49707798 GCGCCTGCCGCTCTGCTTCCTGG - Exonic
1148819542 17:50352686-50352708 GCTGCTGCGCCCCTGCTTCCTGG - Intronic
1149398689 17:56271519-56271541 GCTTCTGCTGCTCTAAGACCAGG - Intronic
1150287789 17:63963700-63963722 TCCGCTGCTGCTCTGCCTCGGGG + Exonic
1150311081 17:64129975-64129997 GCTGCTGCTGCCCGGCCTCGGGG - Exonic
1150492483 17:65584013-65584035 GCAGCTGCAGCTCTGCGACCAGG + Intronic
1151384461 17:73746662-73746684 GCTGCTGCTGCTCAGGCCCCAGG + Intergenic
1151387175 17:73762151-73762173 CGTGCTGCTGCTTTGGGTCCTGG + Intergenic
1151537928 17:74749140-74749162 GCTGCAGAAGCTCGGCGTCCAGG + Exonic
1151651846 17:75475137-75475159 GATGCTGCTGCTCTGCAATCTGG - Intronic
1151755886 17:76075027-76075049 GGTGCTGCTGCGCGGCGGCCAGG + Exonic
1151757107 17:76081375-76081397 GCAGCTGGTGCCCTGCTTCCAGG + Exonic
1151786477 17:76277426-76277448 GCCCCTGCTGCTCAGCCTCCCGG - Intronic
1151858243 17:76737859-76737881 GCTCCGTCGGCTCTGCGTCCTGG + Exonic
1152231619 17:79116866-79116888 GCTGCTGATGCTGTGGGCCCAGG - Intronic
1153334769 18:3911930-3911952 GATGCTGCTGCTGTGGGCCCAGG - Intronic
1153488986 18:5629365-5629387 GCTCCTGCGCCTCTGCCTCCCGG + Intronic
1153805412 18:8705696-8705718 GCGGCTGCAGCTTCGCGTCCGGG - Intronic
1154112600 18:11583114-11583136 GCTGCCACTGCTCTGCAACCAGG - Intergenic
1154317780 18:13319161-13319183 GCTGCTGCTCCTCTCTGTCATGG + Intronic
1157222735 18:45839046-45839068 GCTGCTGCTGCTCGGGGTCCTGG + Exonic
1158480998 18:57821752-57821774 ACTGCTGCTGCTCCTGGTCCAGG - Intergenic
1158732856 18:60044913-60044935 GCTGCTGCTCCCCTGTGTCCTGG - Intergenic
1159001546 18:62979320-62979342 GCTGCTGCTGCTGTTGCTCCTGG - Exonic
1160182535 18:76647891-76647913 GCTGCTGCTGCTCAGCCCTCTGG + Intergenic
1160244359 18:77145265-77145287 GCTGCCCCTTCTCTGCCTCCAGG + Intergenic
1160722921 19:605123-605145 GATGCTGCTGCTCTGCCACTGGG + Exonic
1160777819 19:864361-864383 GGTGCCGCTGCTCGTCGTCCTGG - Intergenic
1160810001 19:1009176-1009198 GCTGCTGCTGCTCCACCTCGGGG - Exonic
1161062092 19:2220261-2220283 GCTGCTGCTGCTCTTCAGGCAGG + Intronic
1161735657 19:5990769-5990791 GCTGCTGCCCCTCTGCGCCTGGG - Intergenic
1161800745 19:6415719-6415741 GCTGCAGCTGCTTTGCCTGCAGG + Exonic
1162062987 19:8108027-8108049 GGTCCTGCTGCTCAGCCTCCAGG + Intronic
1163124756 19:15238871-15238893 GCTGCTGCTGCTGTTGCTCCTGG + Exonic
1163220044 19:15912086-15912108 GCTGCTGCTGCTCCTCGGCTGGG - Intergenic
1163723857 19:18911373-18911395 ACTGCTGCTGCCCTGCCCCCAGG - Intronic
1165867276 19:38946432-38946454 CCTGCTGCTGCTCTGGGGCAGGG + Intronic
1167290230 19:48620526-48620548 CCTGCTGCTCCTCTGCTTCAAGG - Exonic
1167650146 19:50724426-50724448 GCTGGTGCAGGCCTGCGTCCAGG - Exonic
1167650970 19:50728427-50728449 GCGCCTGCTGCTCGGCCTCCTGG - Intergenic
1167661227 19:50797074-50797096 TCAGCTGCTGAGCTGCGTCCAGG - Intergenic
1167796616 19:51713612-51713634 GCTGCTGCTGCTTGGGGGCCTGG - Exonic
1168266702 19:55227471-55227493 CCTGCTGCTGCTCATCATCCTGG - Exonic
1168339590 19:55615505-55615527 GCTCCAGCTGCCCTGCGCCCTGG + Exonic
1168712888 19:58511895-58511917 GCTGCTCCTGCTCTGGGGCCTGG - Exonic
925684647 2:6458683-6458705 GCTGCTGCTACTCTTGGTCTGGG - Intergenic
926310262 2:11669865-11669887 GCTGCTGCTGGTCGGCGTGCCGG - Exonic
926531542 2:14052561-14052583 GGTTCTGAAGCTCTGCGTCCTGG + Intergenic
926586788 2:14695487-14695509 GCTGTTGCTGGTCTTCTTCCAGG - Intergenic
927208891 2:20626818-20626840 GCTTCTGCTCCTCTGAGACCTGG + Intronic
927708610 2:25311956-25311978 GCTGCTGCTGCTCTGGGCTGCGG - Intronic
927786855 2:25980685-25980707 CCTGCGGCTGCTCTTCCTCCGGG + Exonic
931273642 2:60724627-60724649 GCTGCAGCTACTCTGCTTCCTGG - Intergenic
931653397 2:64488808-64488830 GCTGCTGCTGCGATGAGTCTGGG - Intergenic
932777805 2:74538985-74539007 GCTGCTGCTGCTCCTCCTCTTGG + Intronic
933448104 2:82408644-82408666 GCTGCTCCTGCTTTGCCTTCTGG - Intergenic
933727249 2:85433922-85433944 CCTGCTGCTTCTCTGCAGCCTGG - Intronic
934943343 2:98518485-98518507 GCTGCTGCTGCTGGGCCCCCAGG - Intronic
935834460 2:107036134-107036156 GCTGTTGCTGCTCAGCCCCCTGG + Intergenic
938116434 2:128605812-128605834 GCTGCTTCTGCTCTGTCTCATGG + Intergenic
938447360 2:131389288-131389310 GCTGCCACTGCTCTGAGTCTGGG + Intergenic
938922728 2:136009771-136009793 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
940931192 2:159434054-159434076 ACTGCTGCTGCTCAGCATCAAGG + Intronic
941327843 2:164139978-164140000 GCTGCTGCTGCTCTGACAGCAGG + Intergenic
942139782 2:172966466-172966488 GCTGCTGCTGCTGCTCCTCCAGG + Intronic
942392821 2:175513770-175513792 GTTGCTGCTGCTATTGGTCCTGG + Intergenic
943369723 2:187002141-187002163 GCTGCTGCTGCTCTTCTCCATGG + Intergenic
943736884 2:191366039-191366061 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
944370272 2:198974219-198974241 CCTGCTGCTCCTCTGGGTCTAGG - Intergenic
944581717 2:201137783-201137805 GCTGCTGCTGCTCTTCTCCATGG + Intronic
944700237 2:202239512-202239534 GCTGCTGCAGCTCTGCAGGCCGG - Intergenic
944890752 2:204114997-204115019 GCTGCTTCTGCTCTGCCTTGAGG + Intergenic
945326980 2:208493367-208493389 GCTGCTGGTGCTGTGCGTCACGG - Exonic
945988180 2:216371497-216371519 GCGACTGCTGCTCGGCGTCCGGG + Exonic
946109390 2:217401091-217401113 GCTGCTGCTGCTCTTCCTGCAGG - Intronic
947028878 2:225770189-225770211 GCTGCTGCTGCACTGCAGCCAGG + Intergenic
947506637 2:230712968-230712990 GCGGCTGCTGCTGTGGGGCCCGG - Exonic
947740311 2:232481849-232481871 GATGCTGCTGCTGTGGGCCCAGG - Exonic
947877594 2:233477991-233478013 GCGGCAGGTGCTCTGCGGCCGGG + Intronic
948214774 2:236220490-236220512 AATGCTGCTTCTCTGCCTCCTGG + Intronic
948278099 2:236725469-236725491 GCCGCATCTGCTCTGTGTCCTGG - Intergenic
949041588 2:241852225-241852247 GGTGCTGCTAGTCTGGGTCCTGG - Exonic
1168831666 20:848442-848464 GCAGCTGCTGCCCTGTCTCCTGG + Intronic
1168838243 20:892013-892035 CCTGCTGCTACTCTGCATCAAGG - Intronic
1168958886 20:1854763-1854785 GCTGCTGCTGCTGCTGGTCCTGG - Intergenic
1169197203 20:3689658-3689680 CCAGCAGCTGCTCTGGGTCCTGG - Exonic
1171935818 20:31274190-31274212 GCTGCTGCTCCTCTCTGCCCTGG + Intergenic
1172189873 20:33055453-33055475 CCTGCTTCTGCTCTGGGGCCTGG + Exonic
1172705456 20:36879163-36879185 GCTGCTGGTGCTCAGGGACCAGG + Exonic
1172970933 20:38872627-38872649 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1173540375 20:43846749-43846771 GCAGCTGCTGCTCTGTGACAGGG - Intergenic
1174858761 20:54070481-54070503 GCTGCTCCTGCACAGGGTCCTGG + Exonic
1175084939 20:56450595-56450617 ACTGCTGCTTCTCTGGCTCCTGG - Exonic
1175465142 20:59185677-59185699 GCTGTTGATGCTCTGTGTCCTGG + Intergenic
1175910038 20:62400739-62400761 GCTGCAGCTCCTCTGCGTCCTGG - Intronic
1175972743 20:62695105-62695127 CCTGCACCTGCTCTGCGTCCTGG + Intergenic
1176031487 20:63015156-63015178 GCAGCTGCTGCTGTGGGCCCTGG + Intergenic
1176839214 21:13825427-13825449 GCTGGTCCTGCTGTGCATCCTGG - Intergenic
1178030521 21:28520637-28520659 GCTGCTGCCGCTGTTGGTCCTGG + Intergenic
1178329127 21:31671953-31671975 GCTGCTGCTGCTGTGGTTGCTGG + Exonic
1178628179 21:34235999-34236021 TATTCTGCTGCTCTGGGTCCAGG + Intergenic
1179111289 21:38447774-38447796 GCTGCTGCCTCTCTCCTTCCTGG + Intronic
1179175154 21:39002941-39002963 GTAGCTGCTGCTCTGCCTCTGGG - Intergenic
1180074441 21:45455563-45455585 GCTGCTGCTCTTCTGCTGCCTGG + Exonic
1180590474 22:16932967-16932989 GCTGCTGATGCTCTGCTTGGAGG - Intergenic
1180614647 22:17119663-17119685 GCTGGCGCTGCGCTGCCTCCTGG - Exonic
1181010685 22:20038730-20038752 GCTGCTTCTGCTCTGCCTGTGGG + Intronic
1181986127 22:26800898-26800920 GCTGCTGCTGCTCTGTGGCTGGG + Intergenic
1182358841 22:29735016-29735038 GTTGCTGCAGCACTGCCTCCAGG + Intronic
1182620933 22:31618187-31618209 GCACCTGCTGCTCTACTTCCTGG - Exonic
1183189423 22:36312222-36312244 GCTGATGCTGCGCTTCCTCCAGG - Exonic
1183601737 22:38844015-38844037 GCTGCCGCCGCTCTGAGCCCGGG + Intergenic
1183617080 22:38952416-38952438 GCTGTTCCTGCTCTGTGCCCGGG + Intergenic
1183692757 22:39400057-39400079 GCTGCTGCTGCCGGGCGTCGAGG + Intronic
1184751906 22:46491098-46491120 GGGGATGCTGCTCTGTGTCCTGG - Intronic
1184812143 22:46843386-46843408 GCTGCAGCAGCTCTTCCTCCTGG + Intronic
949335476 3:2970133-2970155 GCTGCTGCTGCACTCCAGCCTGG - Intronic
950052405 3:10002627-10002649 GCTGCTGTTGCTCTGGGTGGAGG - Intronic
950052436 3:10002813-10002835 GTTGCTGGTGCTCTGCGTGGAGG - Intronic
950052494 3:10003074-10003096 GCTGCTGTTGCTCTGGGTATAGG - Intronic
950229334 3:11262541-11262563 GCTGCAGCTGGTCTGTTTCCAGG + Exonic
950304241 3:11906015-11906037 GCTGCTGGTGCTCTGGGTGAAGG - Intergenic
950304539 3:11907885-11907907 GCTGCTGTTGCTCTGGGTGGAGG - Intergenic
950304614 3:11908303-11908325 GCTGCTGGTGCTCTGGGTAGAGG - Intergenic
950304633 3:11908390-11908412 GCTGCTGGTGCTCTGGGTGAAGG - Intergenic
950677009 3:14560404-14560426 GCTGCTCCTTCCCTGCATCCAGG + Intergenic
950831432 3:15879285-15879307 GCTGCTGCTGCTCTTCCCCATGG - Intergenic
951456573 3:22899103-22899125 GGTGCTGCTGTTCTGCATGCTGG + Intergenic
952403634 3:32986171-32986193 GCTGCTCCTGCTCATCGTTCAGG + Intergenic
952742542 3:36748463-36748485 GCTGAGGCTGCCCTGGGTCCTGG - Intergenic
952953886 3:38544827-38544849 GCTGCTGCTGTGCTGTTTCCAGG + Intergenic
953223782 3:40998367-40998389 CCTGCTGAGGCTCTCCGTCCTGG + Intergenic
953816713 3:46163820-46163842 ACTGACGCTGCTCTGCTTCCTGG + Intronic
954216267 3:49126135-49126157 GGTGCTGCTGCCCCGTGTCCTGG - Exonic
954288446 3:49636255-49636277 GCTTCTGCTGCCCTCCCTCCAGG - Intronic
955343555 3:58144001-58144023 GCTGCTGGTCCTCTTCTTCCAGG - Intronic
956392810 3:68791790-68791812 GCTGCTGCTCCTCTGGGACAGGG - Intronic
956801594 3:72764650-72764672 GATGCTGCTGCTCCTGGTCCAGG - Intronic
957062219 3:75491173-75491195 GCTACTGCTGATCTCCTTCCAGG - Intergenic
959006492 3:101026241-101026263 CCTGCTGCTCCTCTGGGTCTAGG + Intergenic
960687416 3:120307916-120307938 GCTGCTGCTGCTCCTGCTCCAGG - Intergenic
960903775 3:122577689-122577711 CCTGCCGCTGCTCTGAGTCCAGG + Exonic
961291176 3:125848231-125848253 GCTGCTGCTGATCTCCTTCCAGG + Intergenic
961819734 3:129569843-129569865 CCTGCTGCTGCTCTCCGTGGTGG - Exonic
961895978 3:130167943-130167965 ACTGCTGCTGATCTCCTTCCAGG - Intergenic
962143565 3:132816850-132816872 GCTGCCACTGCTCTGCACCCAGG + Intergenic
962378509 3:134878003-134878025 GCTCCTCCTGCTCTGCCTCCTGG + Intronic
962669739 3:137692974-137692996 GCAGCTGCTGCTCAGCTTCCAGG - Intergenic
962688256 3:137868217-137868239 GCTGCTGCTGCTGGGGGTCAGGG - Intergenic
964421549 3:156509392-156509414 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
966230147 3:177642603-177642625 GCTGCTGCTGTGCTGGGTGCTGG + Intergenic
966400024 3:179538461-179538483 GCAGATGCTGCTGTGCTTCCTGG - Intergenic
966817758 3:183903382-183903404 GGTGCTGATGCTGTGAGTCCAGG - Intergenic
966860638 3:184229576-184229598 GCTGCAGCGGCTCTGAGTCCCGG - Intronic
968039797 3:195579428-195579450 GCTGCTGCTGCTTTCCGCACTGG - Exonic
968131040 3:196192976-196192998 GCTGCTTCTGCTTTGTGGCCAGG - Intergenic
968404294 4:326776-326798 ACTGATGCTGCTCAGCCTCCTGG - Intergenic
968433953 4:575684-575706 CCTGCTTCTGCTCGGCGTCCTGG - Intergenic
969006118 4:4021258-4021280 GCTGCTGCTGATCTCCTTCCAGG - Intergenic
969462495 4:7336171-7336193 GCTGCCCCTGCCCTGCGTCCTGG + Intronic
969806830 4:9616032-9616054 GCTGCTGCTGATCTCCTTCCAGG + Intergenic
970258981 4:14203819-14203841 ACTTCTGCTGCTCTGAGTCAAGG - Intergenic
970536166 4:17031634-17031656 GCTGCTGTTGCTTTGATTCCGGG + Intergenic
971351837 4:25862674-25862696 GCTGCTCCTGCTCTGCTACCTGG - Exonic
971458721 4:26871108-26871130 GATGCTGCTGCACTGCGAACAGG - Intronic
971757614 4:30722175-30722197 GCGGCTGCTTCTCGCCGTCCGGG - Exonic
972580878 4:40394763-40394785 GCTGCTGCTGCTCTCCATTAGGG - Intergenic
973560254 4:52128261-52128283 GCTGGTGCTGCTCTGTGAACTGG + Intergenic
974877929 4:67720587-67720609 GCATCTGCTGCTCTGTGTGCAGG - Intergenic
974967472 4:68779550-68779572 GCTGCTGCTGCACTGCAGCCTGG - Intergenic
974968299 4:68792446-68792468 GCTGCTGCTGCGCTCCAGCCTGG + Intergenic
975913472 4:79297100-79297122 GCCTCTGCTGCTCTGCATCCTGG + Intronic
976053124 4:81031419-81031441 GCGGCTGCAGCTCGGAGTCCGGG - Exonic
977727331 4:100311448-100311470 GCTCCTACTTCTCTGCTTCCTGG - Intergenic
981053149 4:140331627-140331649 GCTGCTGCTTCTCAGTCTCCTGG + Intronic
981782281 4:148443083-148443105 GCTGCTGCTGCTCTGCTGAGAGG - Intronic
984020188 4:174475690-174475712 GCTGCCACAGCTCTGCTTCCAGG - Intergenic
985261400 4:188118220-188118242 GCTGCTGCTGGTGTAAGTCCTGG + Intergenic
985639053 5:1054643-1054665 GCCGCCGCCCCTCTGCGTCCAGG - Intronic
985947769 5:3200273-3200295 GATGCTGCTGCCCCGTGTCCCGG + Intergenic
986070647 5:4279148-4279170 GCAGCTTCTGCTCTGCCTCTGGG - Intergenic
986305062 5:6508514-6508536 GCTGAAGCTGCTCTGCTGCCTGG - Intergenic
987003604 5:13686818-13686840 GCAGCAGCTGCTCTGGCTCCGGG + Intergenic
989041400 5:37233224-37233246 GCTGCTACTGCACTGCTTCAGGG + Intronic
989693153 5:44169857-44169879 ACTGCTGCTGCTTGGCCTCCTGG - Intergenic
990317921 5:54601612-54601634 GCTGCTGCTGGTCACTGTCCTGG - Intergenic
990399625 5:55425076-55425098 TCTGCTGCTGCTATGCCTCTTGG - Exonic
990443144 5:55866515-55866537 GCTGCTGCTGTTCTGAGGCAGGG + Intronic
990499766 5:56384299-56384321 GCTGTTGCTGCTCAGCTCCCGGG + Intergenic
991703188 5:69334210-69334232 GCTGCTGCTGCTGTGCCGGCTGG - Intergenic
991979445 5:72216018-72216040 TCTGATGCTGATCTGCTTCCTGG + Intergenic
994046370 5:95314906-95314928 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
994508853 5:100677643-100677665 GTTGTTGCTGTTCTGCCTCCTGG + Intergenic
994700162 5:103123371-103123393 GCTGATGTTGCTCGTCGTCCTGG - Intronic
995650438 5:114362480-114362502 GCTGCTGCTGCTCGTCGCGCCGG + Exonic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
997508634 5:134437901-134437923 GCTTCTGCTCCTCTATGTCCTGG + Intergenic
997657884 5:135568786-135568808 ACTGGTGCTGCTCTGAGGCCAGG + Intergenic
998508522 5:142691744-142691766 GCTGCTACTGCTCCTGGTCCAGG + Intronic
1001033562 5:168280444-168280466 TCTGCTGCTGCTCTCCAGCCTGG + Intergenic
1001381604 5:171309742-171309764 GCGGCGGCTGCTCTCCATCCAGG - Exonic
1001934898 5:175696883-175696905 GCTCCTGCTGCACTGCGGCCCGG - Intergenic
1002292753 5:178210894-178210916 CCTGCTGCCGCTCTGCAGCCTGG + Exonic
1002527607 5:179823632-179823654 CTTGCTGCTGCTCTGCTGCCTGG + Intronic
1002697493 5:181100677-181100699 GGTGCTGCGGCGCGGCGTCCCGG + Intergenic
1003165043 6:3670298-3670320 GCTGCTGCTGGTCTGGGTTGGGG + Intergenic
1004096176 6:12556679-12556701 GCTGCTGCTGCTTTGCTCCAGGG + Intergenic
1004469150 6:15913322-15913344 GGTGCTGCTGCACTCCGGCCTGG + Intergenic
1004731939 6:18367001-18367023 GCTGCTGCTGCTCTTCTCCATGG + Intergenic
1006300154 6:33189644-33189666 GCTGATGCTGCCCTGCCTCCAGG - Intronic
1008054877 6:46935992-46936014 GCTGCAGTTGCTCTGCTTTCTGG - Intronic
1008601015 6:53094771-53094793 GCTGCTGCTGCCCAGGCTCCAGG - Intronic
1011073228 6:83408843-83408865 ACTGCTGTTCCTCTGGGTCCAGG + Intronic
1011761996 6:90577182-90577204 TTTGCTGATGCTCTGCATCCAGG + Intronic
1013456509 6:110334390-110334412 GATGCTGCTGCTCTGTGTTTTGG - Intronic
1016055169 6:139571145-139571167 TCAGCTCCTGCTGTGCGTCCTGG - Intergenic
1016164219 6:140920005-140920027 ACTGCTGCTGCCCGGCATCCTGG + Intergenic
1016254507 6:142088364-142088386 GCTGCTGCTCACCTGCGTCCCGG - Exonic
1016422831 6:143902565-143902587 GCTGCTGCTGCTCTGCAGGGAGG + Intronic
1017965253 6:159258617-159258639 GCTGCTCCTCCTCTGCCTCAAGG - Intronic
1019282491 7:207521-207543 GCTGCTCCTGAGCTGCGCCCAGG + Intronic
1019926358 7:4195766-4195788 GCTCCTGCGGCACTGCTTCCAGG - Intronic
1020211567 7:6162217-6162239 GTTGCTGCTTATCTGGGTCCAGG + Exonic
1020326662 7:6979554-6979576 GCTGCTGCTGATCACCTTCCAGG - Intergenic
1022606157 7:31816095-31816117 TTTGCTGCTCCTCTGCGGCCAGG + Exonic
1023018046 7:35985346-35985368 GCTGGGGCTGCACTGCCTCCTGG - Intergenic
1023022093 7:36019626-36019648 GCCGCTCCTGGTCTGCTTCCTGG + Intergenic
1023053992 7:36277208-36277230 GTTCCTGCTGCTCTACTTCCTGG - Intronic
1023995708 7:45157870-45157892 GCTGCTGCTGCTCTGCGGTAAGG + Exonic
1024238173 7:47413896-47413918 GCTGCTGCTGTTGTGGGACCTGG - Intronic
1024273151 7:47657422-47657444 GGCGCTGCTGCTCTGCTGCCTGG + Intronic
1024636280 7:51292898-51292920 GCTGCTGCTACCCTGGGGCCAGG + Intronic
1024984256 7:55181948-55181970 GCTGCTGCTGCTATGTGGCTGGG + Intronic
1025096891 7:56102975-56102997 GCTGCTGCTGCTGTGCTGGCTGG + Exonic
1027560000 7:79717582-79717604 CCTGCTCCTGCTCTTCTTCCAGG - Intergenic
1028017679 7:85735953-85735975 GCTGCTGCTCTTCTGAGTCTAGG - Intergenic
1028477152 7:91265045-91265067 GCTGCTGCTGCTTTGGCTGCTGG + Exonic
1028949674 7:96620350-96620372 GCTGCTGCTGCACTGATTCTAGG - Intronic
1029506486 7:100966497-100966519 GCTGCTGGCGCTGGGCGTCCGGG + Exonic
1030060265 7:105615947-105615969 GCTGCTGCTACTCTGGGGACCGG + Intronic
1032011662 7:128351515-128351537 GCTGCTGCAGCTGTGCGCGCTGG - Exonic
1032018701 7:128394906-128394928 GCTGCTGCTGCTCTTCTCCATGG + Exonic
1032070972 7:128806795-128806817 GGTGCTGCAGCTCTGCCTCATGG - Exonic
1032125384 7:129189208-129189230 GCTGCTGCTGCTGGGGGACCCGG + Exonic
1032854594 7:135823921-135823943 GATGCTGCTGCTGTGGGTCCAGG + Intergenic
1033670549 7:143488764-143488786 GCTGCTGGTGCCCTGCTGCCTGG - Intergenic
1034254943 7:149719796-149719818 GCTGCTGCTATTCTATGTCCCGG + Intronic
1034276514 7:149826231-149826253 CCTGCCGTTGCTCTGTGTCCTGG - Intergenic
1034537697 7:151736068-151736090 GCTGATGCTCCTCTGGCTCCCGG - Intronic
1034814319 7:154158859-154158881 GCTGCTGCTGCTCTAGGACACGG + Intronic
1035016624 7:155772232-155772254 GCTGCTGCAGCCGTGCCTCCGGG - Intronic
1035029450 7:155848045-155848067 GATGCTGCTGCTCTGAGCACTGG + Intergenic
1035029464 7:155848133-155848155 GCTGGTGAGGCTCTGCGTTCAGG + Intergenic
1035368949 7:158366588-158366610 GCTGCCGGGGCTCTGCGTTCGGG - Intronic
1035378081 7:158420207-158420229 GGTGCTGATGCTCTGAGTTCAGG - Intronic
1035901175 8:3459773-3459795 GTTGATGCTGCTCTGATTCCTGG - Intronic
1036369957 8:8154373-8154395 ACTGCTGCTGATCTCCTTCCAGG + Intergenic
1036489263 8:9209979-9210001 TCTGCTGCTGCTCTTCTTCTGGG + Intergenic
1036579001 8:10055052-10055074 GCTGCAGGTGCCCTGGGTCCCGG - Intronic
1036880935 8:12511257-12511279 ACTGCTGCTGATCTCCTTCCAGG - Intergenic
1040558679 8:48504289-48504311 GCTGCTGCCGCTTGGCTTCCTGG + Intergenic
1041028584 8:53712451-53712473 GGACCTGCTGCTCTGCGCCCCGG - Intergenic
1042595183 8:70439748-70439770 GCTTCTGCTGCTCTGTGCCAAGG + Intergenic
1043515234 8:80989838-80989860 GCTGCTGCTGCTGTGGGTGGAGG + Intronic
1043866688 8:85382984-85383006 GCTGGTGCTGCTGTGCCTGCCGG - Intronic
1044842129 8:96345409-96345431 GCTGCATCTGCTCTGCATCTAGG + Intergenic
1045594456 8:103636236-103636258 GCTGTTGCTGCTCAGTGCCCTGG + Intronic
1047275439 8:123401820-123401842 GCTGCTGCTGCTCTTCTCCATGG - Intronic
1047401702 8:124553636-124553658 ACTCCTGCTGATCTGCCTCCTGG + Exonic
1047627097 8:126667320-126667342 ACTGCTGTTGCTGTGCCTCCTGG + Intergenic
1048331708 8:133475209-133475231 ACTGCTGCAGCTCTGAGCCCAGG + Intronic
1048458333 8:134598549-134598571 GCTGCTGATGCTCGGCCTCCTGG - Intronic
1049183395 8:141235160-141235182 ACTGCTGCTGCTGTGGGTCGGGG - Intronic
1049277176 8:141725720-141725742 TCTGCAGCTGCTCTGCGGCTTGG + Intergenic
1049351591 8:142167518-142167540 GCTGCTGCTGGCCTGAGCCCAGG - Intergenic
1049395361 8:142397742-142397764 GCAGCTGCTGCTCATTGTCCTGG - Intronic
1049555498 8:143279365-143279387 GCTCCAGGTGGTCTGCGTCCAGG - Intergenic
1049570880 8:143369771-143369793 GCTGCTCCTGCTCCTCGCCCCGG + Intronic
1049923771 9:389586-389608 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1050153503 9:2641304-2641326 GCTGCTGCTCCTGTGCTGCCTGG - Intronic
1051248549 9:15136280-15136302 GCTGCTGTAGCTCTGAGTGCTGG - Intergenic
1051894223 9:21971154-21971176 GCTGCTGCTGCTCCACGGCGCGG - Exonic
1051897761 9:22006193-22006215 GCTGCTGCTGCTCCACGGCGCGG - Exonic
1052940172 9:34126555-34126577 TCTGCTGCCGCTCCGGGTCCGGG - Exonic
1052941257 9:34133424-34133446 GCTGCTGCTGCTCTTCTCCATGG + Intergenic
1055741236 9:79391618-79391640 GCTGCTGCTGCTGTGCCGGCTGG - Intergenic
1056579908 9:87883175-87883197 CCTGCTGCTCCTCTTCCTCCCGG - Exonic
1056972813 9:91221991-91222013 TCTGCTGCTCCTCTGCCTCTTGG - Intronic
1057054421 9:91949915-91949937 GCGGCCGCTGCTGTGCATCCCGG - Exonic
1057303446 9:93899500-93899522 ACTGCTGCTGCTCTGCCTGGAGG - Intergenic
1060929506 9:127479883-127479905 GCCGCTGCCGCTCTGCGTTGAGG - Exonic
1060993471 9:127862182-127862204 GCCCCTGCTGCTGTGCGACCTGG + Intergenic
1061449336 9:130660107-130660129 GCCGGTGCTGCGCTCCGTCCTGG - Intergenic
1061478405 9:130884359-130884381 GCGGCTGCTGGTCAGCGTGCTGG - Exonic
1061884253 9:133583674-133583696 GCTGCAGCTCCTCTGGGCCCAGG + Intronic
1187966211 X:24614931-24614953 GCTGCTGCTGCTACTAGTCCTGG - Intronic
1189282983 X:39832299-39832321 ACTCCTGCTGGTCTGCTTCCTGG + Intergenic
1189992814 X:46610613-46610635 GCTGCTGCTGCTTTGAGCCGGGG - Intronic
1191797299 X:65034885-65034907 GCCGCCGCTGCTCTGTGGCCAGG + Intergenic
1192260896 X:69505344-69505366 GCTGCTGCTGCTGGGCTCCCAGG + Exonic
1192358257 X:70423196-70423218 CCTGCAGCTGCTCTGTGGCCTGG - Exonic
1194854841 X:98915763-98915785 GCTGTCGCTGCTCAGCTTCCTGG + Intergenic
1195305282 X:103575998-103576020 GCTCATGCAACTCTGCGTCCTGG - Intergenic
1196730212 X:118934123-118934145 TCTTCTGCTGCTCTTCTTCCTGG + Intergenic
1198509135 X:137331493-137331515 GCTGCTGCTGTTATAAGTCCTGG - Intergenic
1199307244 X:146280453-146280475 ACTGTTGCTGCTCAGCCTCCTGG + Intergenic
1200074530 X:153544554-153544576 CCAGCTGCTGCTCTCCCTCCAGG - Intronic
1200161758 X:154013235-154013257 TCTGCAGCTGCTCTGCTGCCTGG + Exonic
1201468881 Y:14313159-14313181 GGTGCTGCTGCAGGGCGTCCAGG - Intergenic
1202080416 Y:21078388-21078410 GATTCTTCTGCTCTGCGTACAGG + Intergenic