ID: 1138600228

View in Genome Browser
Species Human (GRCh38)
Location 16:58049657-58049679
Sequence ATGGTCAGTGTCTGGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138600228_1138600235 -3 Left 1138600228 16:58049657-58049679 CCAGGCACCCAGACACTGACCAT No data
Right 1138600235 16:58049677-58049699 CATGGCTCCATCACTCAGGGTGG No data
1138600228_1138600232 -7 Left 1138600228 16:58049657-58049679 CCAGGCACCCAGACACTGACCAT No data
Right 1138600232 16:58049673-58049695 TGACCATGGCTCCATCACTCAGG No data
1138600228_1138600240 11 Left 1138600228 16:58049657-58049679 CCAGGCACCCAGACACTGACCAT No data
Right 1138600240 16:58049691-58049713 TCAGGGTGGGGGTGCGTCCTTGG No data
1138600228_1138600241 12 Left 1138600228 16:58049657-58049679 CCAGGCACCCAGACACTGACCAT No data
Right 1138600241 16:58049692-58049714 CAGGGTGGGGGTGCGTCCTTGGG No data
1138600228_1138600237 -1 Left 1138600228 16:58049657-58049679 CCAGGCACCCAGACACTGACCAT No data
Right 1138600237 16:58049679-58049701 TGGCTCCATCACTCAGGGTGGGG No data
1138600228_1138600233 -6 Left 1138600228 16:58049657-58049679 CCAGGCACCCAGACACTGACCAT No data
Right 1138600233 16:58049674-58049696 GACCATGGCTCCATCACTCAGGG No data
1138600228_1138600236 -2 Left 1138600228 16:58049657-58049679 CCAGGCACCCAGACACTGACCAT No data
Right 1138600236 16:58049678-58049700 ATGGCTCCATCACTCAGGGTGGG No data
1138600228_1138600238 0 Left 1138600228 16:58049657-58049679 CCAGGCACCCAGACACTGACCAT No data
Right 1138600238 16:58049680-58049702 GGCTCCATCACTCAGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138600228 Original CRISPR ATGGTCAGTGTCTGGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr