ID: 1138601113

View in Genome Browser
Species Human (GRCh38)
Location 16:58055124-58055146
Sequence CCCAAGGCTCAGAGAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138601106_1138601113 21 Left 1138601106 16:58055080-58055102 CCCCGTTGAGGGAGTTCGTCTGC No data
Right 1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG No data
1138601108_1138601113 19 Left 1138601108 16:58055082-58055104 CCGTTGAGGGAGTTCGTCTGCTT No data
Right 1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG No data
1138601107_1138601113 20 Left 1138601107 16:58055081-58055103 CCCGTTGAGGGAGTTCGTCTGCT No data
Right 1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138601113 Original CRISPR CCCAAGGCTCAGAGAGGTGA AGG Intergenic
No off target data available for this crispr