ID: 1138601200

View in Genome Browser
Species Human (GRCh38)
Location 16:58055683-58055705
Sequence GAGCAAGCACAAAGATCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138601199_1138601200 -9 Left 1138601199 16:58055669-58055691 CCAGGCAGAGGGAGGAGCAAGCA No data
Right 1138601200 16:58055683-58055705 GAGCAAGCACAAAGATCCTGAGG No data
1138601190_1138601200 29 Left 1138601190 16:58055631-58055653 CCTCCTTACTGAGGTCACATTCT No data
Right 1138601200 16:58055683-58055705 GAGCAAGCACAAAGATCCTGAGG No data
1138601191_1138601200 26 Left 1138601191 16:58055634-58055656 CCTTACTGAGGTCACATTCTAGG No data
Right 1138601200 16:58055683-58055705 GAGCAAGCACAAAGATCCTGAGG No data
1138601189_1138601200 30 Left 1138601189 16:58055630-58055652 CCCTCCTTACTGAGGTCACATTC No data
Right 1138601200 16:58055683-58055705 GAGCAAGCACAAAGATCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138601200 Original CRISPR GAGCAAGCACAAAGATCCTG AGG Intergenic