ID: 1138605559

View in Genome Browser
Species Human (GRCh38)
Location 16:58086194-58086216
Sequence GATCCCACAGGCTGCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138605559_1138605571 17 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605571 16:58086234-58086256 ATCCATGCCCAGGGGCAGGGAGG No data
1138605559_1138605569 13 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605569 16:58086230-58086252 AGGGATCCATGCCCAGGGGCAGG No data
1138605559_1138605563 -6 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605563 16:58086211-58086233 GGGATCCATGAATCCGAACAGGG No data
1138605559_1138605562 -7 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605562 16:58086210-58086232 TGGGATCCATGAATCCGAACAGG No data
1138605559_1138605566 7 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605566 16:58086224-58086246 CCGAACAGGGATCCATGCCCAGG No data
1138605559_1138605568 9 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605568 16:58086226-58086248 GAACAGGGATCCATGCCCAGGGG No data
1138605559_1138605576 26 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605576 16:58086243-58086265 CAGGGGCAGGGAGGGATCTCCGG No data
1138605559_1138605572 18 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605572 16:58086235-58086257 TCCATGCCCAGGGGCAGGGAGGG No data
1138605559_1138605570 14 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605570 16:58086231-58086253 GGGATCCATGCCCAGGGGCAGGG No data
1138605559_1138605567 8 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605567 16:58086225-58086247 CGAACAGGGATCCATGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138605559 Original CRISPR GATCCCACAGGCTGCTCAGA GGG (reversed) Intergenic
No off target data available for this crispr