ID: 1138605562

View in Genome Browser
Species Human (GRCh38)
Location 16:58086210-58086232
Sequence TGGGATCCATGAATCCGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138605560_1138605562 -8 Left 1138605560 16:58086195-58086217 CCTCTGAGCAGCCTGTGGGATCC No data
Right 1138605562 16:58086210-58086232 TGGGATCCATGAATCCGAACAGG No data
1138605559_1138605562 -7 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605562 16:58086210-58086232 TGGGATCCATGAATCCGAACAGG No data
1138605556_1138605562 0 Left 1138605556 16:58086187-58086209 CCTGAGTCCCTCTGAGCAGCCTG No data
Right 1138605562 16:58086210-58086232 TGGGATCCATGAATCCGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138605562 Original CRISPR TGGGATCCATGAATCCGAAC AGG Intergenic
No off target data available for this crispr