ID: 1138605566

View in Genome Browser
Species Human (GRCh38)
Location 16:58086224-58086246
Sequence CCGAACAGGGATCCATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138605560_1138605566 6 Left 1138605560 16:58086195-58086217 CCTCTGAGCAGCCTGTGGGATCC No data
Right 1138605566 16:58086224-58086246 CCGAACAGGGATCCATGCCCAGG No data
1138605559_1138605566 7 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605566 16:58086224-58086246 CCGAACAGGGATCCATGCCCAGG No data
1138605561_1138605566 -5 Left 1138605561 16:58086206-58086228 CCTGTGGGATCCATGAATCCGAA No data
Right 1138605566 16:58086224-58086246 CCGAACAGGGATCCATGCCCAGG No data
1138605556_1138605566 14 Left 1138605556 16:58086187-58086209 CCTGAGTCCCTCTGAGCAGCCTG No data
Right 1138605566 16:58086224-58086246 CCGAACAGGGATCCATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138605566 Original CRISPR CCGAACAGGGATCCATGCCC AGG Intergenic
No off target data available for this crispr