ID: 1138605569

View in Genome Browser
Species Human (GRCh38)
Location 16:58086230-58086252
Sequence AGGGATCCATGCCCAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138605559_1138605569 13 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605569 16:58086230-58086252 AGGGATCCATGCCCAGGGGCAGG No data
1138605556_1138605569 20 Left 1138605556 16:58086187-58086209 CCTGAGTCCCTCTGAGCAGCCTG No data
Right 1138605569 16:58086230-58086252 AGGGATCCATGCCCAGGGGCAGG No data
1138605560_1138605569 12 Left 1138605560 16:58086195-58086217 CCTCTGAGCAGCCTGTGGGATCC No data
Right 1138605569 16:58086230-58086252 AGGGATCCATGCCCAGGGGCAGG No data
1138605561_1138605569 1 Left 1138605561 16:58086206-58086228 CCTGTGGGATCCATGAATCCGAA No data
Right 1138605569 16:58086230-58086252 AGGGATCCATGCCCAGGGGCAGG No data
1138605564_1138605569 -9 Left 1138605564 16:58086216-58086238 CCATGAATCCGAACAGGGATCCA No data
Right 1138605569 16:58086230-58086252 AGGGATCCATGCCCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138605569 Original CRISPR AGGGATCCATGCCCAGGGGC AGG Intergenic
No off target data available for this crispr