ID: 1138605576

View in Genome Browser
Species Human (GRCh38)
Location 16:58086243-58086265
Sequence CAGGGGCAGGGAGGGATCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138605561_1138605576 14 Left 1138605561 16:58086206-58086228 CCTGTGGGATCCATGAATCCGAA No data
Right 1138605576 16:58086243-58086265 CAGGGGCAGGGAGGGATCTCCGG No data
1138605565_1138605576 -4 Left 1138605565 16:58086224-58086246 CCGAACAGGGATCCATGCCCAGG No data
Right 1138605576 16:58086243-58086265 CAGGGGCAGGGAGGGATCTCCGG No data
1138605560_1138605576 25 Left 1138605560 16:58086195-58086217 CCTCTGAGCAGCCTGTGGGATCC No data
Right 1138605576 16:58086243-58086265 CAGGGGCAGGGAGGGATCTCCGG No data
1138605559_1138605576 26 Left 1138605559 16:58086194-58086216 CCCTCTGAGCAGCCTGTGGGATC No data
Right 1138605576 16:58086243-58086265 CAGGGGCAGGGAGGGATCTCCGG No data
1138605564_1138605576 4 Left 1138605564 16:58086216-58086238 CCATGAATCCGAACAGGGATCCA No data
Right 1138605576 16:58086243-58086265 CAGGGGCAGGGAGGGATCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138605576 Original CRISPR CAGGGGCAGGGAGGGATCTC CGG Intergenic
No off target data available for this crispr