ID: 1138607343

View in Genome Browser
Species Human (GRCh38)
Location 16:58097514-58097536
Sequence AGGGTCCAACCCGGCAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138607343_1138607346 -9 Left 1138607343 16:58097514-58097536 CCTGTGCTGCCGGGTTGGACCCT No data
Right 1138607346 16:58097528-58097550 TTGGACCCTCTGGCACAAGCAGG No data
1138607343_1138607349 8 Left 1138607343 16:58097514-58097536 CCTGTGCTGCCGGGTTGGACCCT No data
Right 1138607349 16:58097545-58097567 AGCAGGCTCTGACCCCAGAGTGG No data
1138607343_1138607350 9 Left 1138607343 16:58097514-58097536 CCTGTGCTGCCGGGTTGGACCCT No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data
1138607343_1138607351 10 Left 1138607343 16:58097514-58097536 CCTGTGCTGCCGGGTTGGACCCT No data
Right 1138607351 16:58097547-58097569 CAGGCTCTGACCCCAGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138607343 Original CRISPR AGGGTCCAACCCGGCAGCAC AGG (reversed) Intergenic
No off target data available for this crispr