ID: 1138607346

View in Genome Browser
Species Human (GRCh38)
Location 16:58097528-58097550
Sequence TTGGACCCTCTGGCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138607343_1138607346 -9 Left 1138607343 16:58097514-58097536 CCTGTGCTGCCGGGTTGGACCCT No data
Right 1138607346 16:58097528-58097550 TTGGACCCTCTGGCACAAGCAGG No data
1138607338_1138607346 -3 Left 1138607338 16:58097508-58097530 CCGCCCCCTGTGCTGCCGGGTTG No data
Right 1138607346 16:58097528-58097550 TTGGACCCTCTGGCACAAGCAGG No data
1138607340_1138607346 -6 Left 1138607340 16:58097511-58097533 CCCCCTGTGCTGCCGGGTTGGAC No data
Right 1138607346 16:58097528-58097550 TTGGACCCTCTGGCACAAGCAGG No data
1138607334_1138607346 24 Left 1138607334 16:58097481-58097503 CCCTGAAGACAACTCACTCAGGT No data
Right 1138607346 16:58097528-58097550 TTGGACCCTCTGGCACAAGCAGG No data
1138607335_1138607346 23 Left 1138607335 16:58097482-58097504 CCTGAAGACAACTCACTCAGGTG No data
Right 1138607346 16:58097528-58097550 TTGGACCCTCTGGCACAAGCAGG No data
1138607341_1138607346 -7 Left 1138607341 16:58097512-58097534 CCCCTGTGCTGCCGGGTTGGACC No data
Right 1138607346 16:58097528-58097550 TTGGACCCTCTGGCACAAGCAGG No data
1138607342_1138607346 -8 Left 1138607342 16:58097513-58097535 CCCTGTGCTGCCGGGTTGGACCC No data
Right 1138607346 16:58097528-58097550 TTGGACCCTCTGGCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138607346 Original CRISPR TTGGACCCTCTGGCACAAGC AGG Intergenic
No off target data available for this crispr