ID: 1138607347

View in Genome Browser
Species Human (GRCh38)
Location 16:58097533-58097555
Sequence CAGAGCCTGCTTGTGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138607347_1138607351 -9 Left 1138607347 16:58097533-58097555 CCCTCTGGCACAAGCAGGCTCTG No data
Right 1138607351 16:58097547-58097569 CAGGCTCTGACCCCAGAGTGGGG No data
1138607347_1138607350 -10 Left 1138607347 16:58097533-58097555 CCCTCTGGCACAAGCAGGCTCTG No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138607347 Original CRISPR CAGAGCCTGCTTGTGCCAGA GGG (reversed) Intergenic
No off target data available for this crispr