ID: 1138607350

View in Genome Browser
Species Human (GRCh38)
Location 16:58097546-58097568
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138607347_1138607350 -10 Left 1138607347 16:58097533-58097555 CCCTCTGGCACAAGCAGGCTCTG No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data
1138607342_1138607350 10 Left 1138607342 16:58097513-58097535 CCCTGTGCTGCCGGGTTGGACCC No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data
1138607345_1138607350 0 Left 1138607345 16:58097523-58097545 CCGGGTTGGACCCTCTGGCACAA No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data
1138607341_1138607350 11 Left 1138607341 16:58097512-58097534 CCCCTGTGCTGCCGGGTTGGACC No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data
1138607340_1138607350 12 Left 1138607340 16:58097511-58097533 CCCCCTGTGCTGCCGGGTTGGAC No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data
1138607343_1138607350 9 Left 1138607343 16:58097514-58097536 CCTGTGCTGCCGGGTTGGACCCT No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data
1138607338_1138607350 15 Left 1138607338 16:58097508-58097530 CCGCCCCCTGTGCTGCCGGGTTG No data
Right 1138607350 16:58097546-58097568 GCAGGCTCTGACCCCAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138607350 Original CRISPR GCAGGCTCTGACCCCAGAGT GGG Intergenic
No off target data available for this crispr