ID: 1138608274

View in Genome Browser
Species Human (GRCh38)
Location 16:58102870-58102892
Sequence CTGTAGTTAAGCATGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138608267_1138608274 27 Left 1138608267 16:58102820-58102842 CCTGATGGCTTAGGCTGGGACCT No data
Right 1138608274 16:58102870-58102892 CTGTAGTTAAGCATGTCATGGGG No data
1138608270_1138608274 7 Left 1138608270 16:58102840-58102862 CCTGGCACGGAATGTCACTTCTG No data
Right 1138608274 16:58102870-58102892 CTGTAGTTAAGCATGTCATGGGG No data
1138608266_1138608274 30 Left 1138608266 16:58102817-58102839 CCTCCTGATGGCTTAGGCTGGGA No data
Right 1138608274 16:58102870-58102892 CTGTAGTTAAGCATGTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138608274 Original CRISPR CTGTAGTTAAGCATGTCATG GGG Intergenic
No off target data available for this crispr