ID: 1138612581

View in Genome Browser
Species Human (GRCh38)
Location 16:58138427-58138449
Sequence CTGTTTCCACACATTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138612581_1138612585 22 Left 1138612581 16:58138427-58138449 CCTTCTGCAATGTGTGGAAACAG No data
Right 1138612585 16:58138472-58138494 AATGCTAGCACCATGCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138612581 Original CRISPR CTGTTTCCACACATTGCAGA AGG (reversed) Intergenic
No off target data available for this crispr