ID: 1138614807

View in Genome Browser
Species Human (GRCh38)
Location 16:58156941-58156963
Sequence TGGTCCTCAGCTCAAGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138614807_1138614813 11 Left 1138614807 16:58156941-58156963 CCACTGTCTTGAGCTGAGGACCA No data
Right 1138614813 16:58156975-58156997 GAAGTCTCATTTGTAGCATTGGG No data
1138614807_1138614812 10 Left 1138614807 16:58156941-58156963 CCACTGTCTTGAGCTGAGGACCA No data
Right 1138614812 16:58156974-58156996 CGAAGTCTCATTTGTAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138614807 Original CRISPR TGGTCCTCAGCTCAAGACAG TGG (reversed) Intergenic