ID: 1138615293

View in Genome Browser
Species Human (GRCh38)
Location 16:58160614-58160636
Sequence GGTCCCAGTGGACTGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138615293_1138615300 4 Left 1138615293 16:58160614-58160636 CCACCTTTCAGTCCACTGGGACC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1138615300 16:58160641-58160663 CAGTGGGCAGCGCCCTCCCCAGG 0: 1
1: 0
2: 4
3: 37
4: 286
1138615293_1138615301 5 Left 1138615293 16:58160614-58160636 CCACCTTTCAGTCCACTGGGACC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1138615301 16:58160642-58160664 AGTGGGCAGCGCCCTCCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 247
1138615293_1138615307 28 Left 1138615293 16:58160614-58160636 CCACCTTTCAGTCCACTGGGACC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1138615307 16:58160665-58160687 TACATTCCAGAACATAAACTTGG 0: 1
1: 0
2: 1
3: 19
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138615293 Original CRISPR GGTCCCAGTGGACTGAAAGG TGG (reversed) Intronic
902583501 1:17424080-17424102 AGTCTCAGTGGACTGAGATGCGG + Intronic
903353068 1:22729928-22729950 GCTCTCAGATGACTGAAAGGAGG + Intronic
903844297 1:26268433-26268455 GGTCATAGTGGAGTGAATGGTGG + Intronic
905411074 1:37768460-37768482 GGTTGCAGTGGACTGAAATCAGG - Intergenic
905885756 1:41491032-41491054 GGCCCTGGTGGACAGAAAGGTGG + Intergenic
908032517 1:60016475-60016497 TCTCCCAGTTAACTGAAAGGTGG - Intronic
908690635 1:66775625-66775647 GGACCCAGTGCATGGAAAGGAGG + Intronic
911861876 1:102961897-102961919 GGTGCACCTGGACTGAAAGGAGG - Exonic
912570040 1:110614733-110614755 GGTGCCAGTGGAGATAAAGGAGG - Intronic
914975971 1:152362668-152362690 GGTCCAAGTGGACAGATAGCAGG + Intergenic
916022612 1:160807563-160807585 GGCAGCAGTGGACTGAAGGGTGG + Intronic
916684671 1:167133608-167133630 GGATCCAGGGGACTGAATGGCGG - Intergenic
920831770 1:209471983-209472005 GGTCTCAGAGGCCTGACAGGTGG + Intergenic
921152917 1:212415819-212415841 GCTCCCAGTGGCCTGAGTGGAGG - Intergenic
923533181 1:234827807-234827829 AGTCCCAGTGAACTGAATGAAGG + Intergenic
1063143471 10:3275785-3275807 GCCCCCAGTTGACTGAAAGGGGG + Intergenic
1063205773 10:3829623-3829645 TGTCCCTGTGGACTGAGAGCTGG + Intergenic
1063219897 10:3957248-3957270 GGTCGCAGTGAACTGAGATGGGG - Intergenic
1070421981 10:76246254-76246276 GGTCCTGGCGGACTGAAGGGAGG + Intronic
1071438735 10:85670681-85670703 GGACCCTGTGGGCTGAAGGGTGG - Intronic
1073536855 10:104284788-104284810 AGTCCAAGTGCAGTGAAAGGTGG + Intronic
1074351936 10:112746393-112746415 GGTGCCAGGGCACTGAAAGCAGG - Intronic
1076220900 10:128732243-128732265 TTTCCCATTTGACTGAAAGGTGG + Intergenic
1076426431 10:130370553-130370575 GGTCCCAGTGGCCAGAAATCTGG - Intergenic
1076530897 10:131143494-131143516 TGTCCCAGTGAAGTGACAGGTGG + Intronic
1076868060 10:133178953-133178975 AGTCCCTGTGGACAGAGAGGTGG + Intronic
1079597182 11:22264361-22264383 GAACCCAGAGGACTGAATGGAGG + Intronic
1080436572 11:32250203-32250225 GGTACCAGGGCACTGAATGGTGG - Intergenic
1084328425 11:68415198-68415220 GGTACCAGTGCACTGAGAGGAGG + Intronic
1085226484 11:74925772-74925794 AGTACCAGTGGGCTGAAGGGAGG - Intronic
1085640565 11:78190030-78190052 GCTCCCAGGGGAGTCAAAGGAGG + Intronic
1088742878 11:112781162-112781184 GGGCCCAGTGAACTCCAAGGTGG + Intergenic
1088940840 11:114454059-114454081 GATACCAGTGGTCTGAAAGATGG - Intergenic
1089022321 11:115229167-115229189 GGTCCCAGTGATCTGCCAGGTGG - Exonic
1089561556 11:119345819-119345841 GGTCCCAGCTGCCTGAGAGGTGG + Exonic
1103256182 12:119543415-119543437 GGTCCCAGTGGACATGAGGGAGG + Intergenic
1104352037 12:128053194-128053216 GGTCCCTTTGGACTGACAGGAGG + Intergenic
1104749535 12:131229609-131229631 GGTCCCTGTGGCCTGCAGGGCGG - Intergenic
1107402653 13:40084552-40084574 GGTCCCAGTGACCTGTAAGTGGG + Intergenic
1108259873 13:48645884-48645906 GGTCCCTGTGACCTGAAGGGTGG - Intergenic
1110436018 13:75479375-75479397 GCTCCCACTGGACTAAAAGGGGG + Intronic
1110807707 13:79776774-79776796 GGGTCCAGTTGACTGAAATGGGG - Intergenic
1112703333 13:102037280-102037302 GGTCTCAGTGGACTAAAATCAGG + Intronic
1112740925 13:102472233-102472255 TGTCCCAGTGGACTGGAGTGGGG - Intergenic
1114531475 14:23399224-23399246 GGACCCACTGGGCAGAAAGGAGG - Intronic
1115471792 14:33775502-33775524 CTTCCCAGTGGACTGAATGCAGG - Intronic
1120093420 14:80360423-80360445 GACCACAGTAGACTGAAAGGTGG + Intronic
1124354612 15:28985416-28985438 GGTCAGAGAGCACTGAAAGGAGG + Intronic
1127833157 15:62768579-62768601 GGACACGGTGGACTGAATGGTGG - Intronic
1134263683 16:12674534-12674556 GCTCCAGGTGGAGTGAAAGGAGG + Intronic
1137593828 16:49710624-49710646 GGTGCCACTGGAATGACAGGTGG + Intronic
1138615293 16:58160614-58160636 GGTCCCAGTGGACTGAAAGGTGG - Intronic
1138802021 16:60044710-60044732 GGTTACAGTGAACTGAAATGTGG + Intergenic
1141096733 16:81168268-81168290 GATCTCAGAGGACTGTAAGGTGG - Intergenic
1142119526 16:88379152-88379174 GGTCCCAGTAGACGGTCAGGAGG - Intergenic
1143320632 17:6066515-6066537 GGTGCCAGTGGCCTGAATGGGGG + Intronic
1143564265 17:7712070-7712092 GGTCCCACTGGACAGAAGAGAGG - Intergenic
1144502649 17:15802672-15802694 TGGCTCAGTGGACTGAAAGAAGG + Intergenic
1145164829 17:20605326-20605348 TGGCTCAGTGGACTGAAAGGCGG + Intergenic
1148050886 17:44769472-44769494 GGGCCCAGAGGGCAGAAAGGGGG + Intronic
1148894638 17:50832756-50832778 GCTCCCAGTGGCCTGAGTGGAGG + Intergenic
1155002817 18:21703890-21703912 AGTCACAGAGGACTGAAACGGGG + Intronic
1160172788 18:76568391-76568413 GGTCTCAGTGGAAGGGAAGGTGG + Intergenic
1161289471 19:3485248-3485270 GGTCCTAGTGGAAGGAAAGTAGG + Intergenic
1163062593 19:14771250-14771272 GGTCCCAGGGGACATTAAGGGGG - Intronic
1163469014 19:17486257-17486279 CGTCGCAGGGGACAGAAAGGAGG + Intronic
1165014134 19:32868548-32868570 GGTTCCAGGAGACTGCAAGGAGG + Exonic
1166857853 19:45792249-45792271 GGTTCCAGAGAACTGATAGGAGG - Intronic
1166880376 19:45926014-45926036 GGTCCCAGCTTAGTGAAAGGAGG + Intergenic
925109855 2:1324144-1324166 GGTCCCAGTAGGCTGAGAGTTGG + Intronic
928624169 2:33122423-33122445 GGCCACAGTGGACTGGAAAGCGG + Intronic
936403349 2:112182569-112182591 GGGCCCAGAGGGCTAAAAGGAGG - Intronic
936964165 2:118110887-118110909 GGTCCCAATGGCCTTAAAGAAGG - Intronic
938406831 2:131037453-131037475 GTACCCAGTGAAGTGAAAGGAGG + Intronic
939140375 2:138346924-138346946 GGTCACATGTGACTGAAAGGAGG - Intergenic
942072671 2:172329715-172329737 GGCCCCAGTGGGCTGGATGGTGG - Intergenic
945694834 2:213089485-213089507 GGTTACAGTGGTCTGAAAGAGGG - Intronic
946460706 2:219865984-219866006 GGGCCCAATGACCTGAAAGGTGG - Intergenic
1172805920 20:37611506-37611528 GGCCACAGTGGATTCAAAGGTGG - Intergenic
1172841377 20:37904343-37904365 GGCCCTAGAGGACTGAAATGTGG + Intronic
1173941063 20:46911776-46911798 GTTCCCAGTGGCTGGAAAGGTGG + Intronic
1176458374 21:6932725-6932747 GGCCCCAGTGAACTGGCAGGGGG - Intergenic
1176836547 21:13797819-13797841 GGCCCCAGTGAACTGGCAGGGGG - Intergenic
1178100866 21:29267250-29267272 GGGAACAGTGGACAGAAAGGTGG - Intronic
1182426885 22:30278321-30278343 GGGCACAGTGGGCAGAAAGGAGG + Intergenic
954071142 3:48143725-48143747 TGTCCCAGTGCTCTGCAAGGCGG + Intergenic
958814444 3:98901093-98901115 GGTCCCAGGGGAGTGAGCGGCGG - Intronic
960526330 3:118715169-118715191 TGTGCCAGTGGACTGAATGGGGG - Intergenic
961144550 3:124583389-124583411 GGTCCAAGTGGGCTTCAAGGGGG + Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
963001327 3:140684528-140684550 GGTCCCATTGGATGTAAAGGTGG + Intronic
963568257 3:146959696-146959718 GAACCTAGTGGAGTGAAAGGAGG - Intergenic
967054827 3:185823361-185823383 GTTCCCAGTAGAAAGAAAGGTGG + Intronic
968279927 3:197468716-197468738 CATCCCAGTAGACTGAGAGGAGG - Intergenic
969207396 4:5657078-5657100 GGTCTCAGTGGTCTGGATGGAGG - Intronic
969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG + Intronic
970024648 4:11610573-11610595 GGTGTCAGTGCACTGAAAGCAGG + Intergenic
978037342 4:104011378-104011400 AGTCCAAGTGGACTGAAAGCAGG + Intergenic
982313035 4:154005119-154005141 GGTCTCAGTGAACTCAGAGGTGG + Intergenic
983683057 4:170374645-170374667 TGTCCCAGTGGCCTGAGAGCTGG + Intergenic
985768643 5:1795510-1795532 GGTGCCAATGAACTGAAAGACGG - Intergenic
986019092 5:3784229-3784251 AGTTCCAGTGAACTGACAGGTGG - Intergenic
987442191 5:17969348-17969370 GGTCCCAGTGGATTCAAATAAGG - Intergenic
990380994 5:55222054-55222076 GGAACCAGTGGACTGACTGGTGG - Intronic
990747317 5:58972456-58972478 GATCTCAGGGGACTGAAATGGGG + Exonic
997265979 5:132495896-132495918 GGCCCCATGGGACTGACAGGGGG - Intergenic
1003102326 6:3186400-3186422 GGTACCAGGGGAATGCAAGGAGG + Intergenic
1006052244 6:31354123-31354145 GGTCACAGTGGACACAAGGGTGG + Exonic
1014535166 6:122605972-122605994 GGCTACAGTGGACTGAATGGTGG + Intronic
1020618549 7:10490715-10490737 GTTCCCAGGGGAGAGAAAGGAGG + Intergenic
1023110102 7:36801425-36801447 GGGCCCAGTGGAATCACAGGTGG - Intergenic
1028503686 7:91547925-91547947 TGTCCCAGTGAGCTGAAGGGGGG + Intergenic
1029854530 7:103501848-103501870 GGTACCAGTGGGATGCAAGGTGG + Intronic
1033635571 7:143208764-143208786 GGTACCAGGAGACTGAGAGGTGG - Intergenic
1041123374 8:54609599-54609621 TCACCCAGTGGAATGAAAGGAGG - Intergenic
1044672783 8:94700184-94700206 GCTTCCAGTGGACTGCATGGTGG + Intronic
1047770777 8:128028243-128028265 GGTCCCAGGAGCCAGAAAGGCGG - Intergenic
1049443785 8:142620864-142620886 GGGCAGAGTGGACTGAATGGAGG + Intergenic
1051268898 9:15335641-15335663 GGTCCCACTTAACTGGAAGGTGG - Intergenic
1052423079 9:28269241-28269263 GGTCCCAGAGGACTGAGATATGG + Intronic
1056237924 9:84614620-84614642 GGTCTCTGTGGGCTGAAAAGTGG - Intergenic
1056723505 9:89091340-89091362 GTTACCAGTGGACTGAAATTAGG + Intronic
1057709847 9:97429686-97429708 GGTGCAAGTAGACAGAAAGGAGG - Intronic
1058467676 9:105245042-105245064 GGACCCGGCGGACGGAAAGGCGG - Intronic
1060382682 9:123191414-123191436 GGGCCGAGAGGACAGAAAGGTGG + Intronic
1060468143 9:123926055-123926077 GATCCCAGTGGACTGGAATGTGG - Intronic
1061431252 9:130532777-130532799 GGTCCCTGAGGGCTGAGAGGAGG + Intergenic
1061518593 9:131104063-131104085 GGTCCCCGGGGACTGAAAAGTGG + Intronic
1061889884 9:133613082-133613104 GATCTCAGGGCACTGAAAGGGGG + Intergenic
1062310252 9:135931568-135931590 GGCCTCTGGGGACTGAAAGGCGG + Intergenic
1186191170 X:7068914-7068936 GGGCCCAGTGGTCTGGAAAGGGG - Intronic
1187197250 X:17099567-17099589 CGTCCCAGTGGAGGGGAAGGGGG - Intronic
1192152299 X:68719778-68719800 GGTCCCACTGGTCTGTAAGGTGG - Intronic
1192205867 X:69095552-69095574 GGTCCCAGAGGCCTGGCAGGTGG + Intergenic
1192582743 X:72298564-72298586 GGTGCCAGTGGCCAGAAATGTGG - Intronic
1195760942 X:108245751-108245773 GGTCCCAGTGATCTGGAAGAAGG + Intronic
1198675555 X:139126862-139126884 GGACCCAGTGGACTGGGATGTGG - Intronic
1200152381 X:153957522-153957544 GGGCCCTTTGGTCTGAAAGGGGG + Exonic