ID: 1138618046

View in Genome Browser
Species Human (GRCh38)
Location 16:58187795-58187817
Sequence GCCATGGGCTCTGTGATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138618046_1138618056 10 Left 1138618046 16:58187795-58187817 CCCAAGATCACAGAGCCCATGGC 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1138618056 16:58187828-58187850 AGGAATCAAAGCTGGAAGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 313
1138618046_1138618054 2 Left 1138618046 16:58187795-58187817 CCCAAGATCACAGAGCCCATGGC 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1138618054 16:58187820-58187842 AGAGGGGCAGGAATCAAAGCTGG 0: 1
1: 0
2: 3
3: 44
4: 462
1138618046_1138618051 -10 Left 1138618046 16:58187795-58187817 CCCAAGATCACAGAGCCCATGGC 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1138618051 16:58187808-58187830 AGCCCATGGCAGAGAGGGGCAGG 0: 1
1: 1
2: 8
3: 62
4: 543
1138618046_1138618055 9 Left 1138618046 16:58187795-58187817 CCCAAGATCACAGAGCCCATGGC 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1138618055 16:58187827-58187849 CAGGAATCAAAGCTGGAAGCTGG 0: 1
1: 0
2: 4
3: 29
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138618046 Original CRISPR GCCATGGGCTCTGTGATCTT GGG (reversed) Intronic
900560545 1:3303815-3303837 GCCGTGGGCTCTTTAATCCTTGG + Intronic
900560586 1:3303987-3304009 GCCATGGGCTCTTTAATCCTTGG + Intronic
900560629 1:3304159-3304181 GCCGTGGGCTCTTTAATCCTTGG + Intronic
900639721 1:3682839-3682861 GTCATGGGCTCTGTTATTCTGGG - Intronic
900699048 1:4032666-4032688 GCCATGGGCTGGGTGGACTTGGG + Intergenic
900812486 1:4817545-4817567 GCCAGGGGCTCTGGGGCCTTTGG + Intergenic
901380699 1:8871863-8871885 GCCATGGGCTGTGGGTTCTAAGG + Intronic
901734123 1:11301479-11301501 GCCATCAGCTCTGAGACCTTGGG - Intergenic
901770897 1:11529882-11529904 GCCATGGTCTTTGTGGTCTTCGG + Exonic
901813225 1:11779374-11779396 CTCATTGGCTGTGTGATCTTGGG + Intronic
902103295 1:14011673-14011695 TCCATGAGCTCTGTGACCTTGGG + Intergenic
903065243 1:20696092-20696114 CTTATGGGCTCTGTGACCTTGGG - Intronic
904113166 1:28142643-28142665 GCCATTCGCTGTGTGACCTTGGG + Intergenic
904586137 1:31581823-31581845 CCCACTGGCTGTGTGATCTTAGG - Intronic
905514479 1:38552070-38552092 GACATGAGCTGTGTGACCTTAGG + Intergenic
905896079 1:41546606-41546628 GCCAATGGCTGTGTGACCTTGGG - Intronic
905993538 1:42360849-42360871 TCCATGTGCTCTGCCATCTTTGG - Intergenic
906163507 1:43668740-43668762 GCCAGGGGATCTGTGCTCTGAGG + Intronic
907409763 1:54275601-54275623 GCCTTGGGCACTGTGAGCTGTGG - Intronic
907481452 1:54748133-54748155 CCCATGGGCTCTGCCTTCTTTGG + Intergenic
907669124 1:56459224-56459246 GCCAGGGGCTCTTGGACCTTTGG + Intergenic
909265552 1:73553431-73553453 GCCAGGGGCTCTTTGGCCTTTGG + Intergenic
909358477 1:74734690-74734712 ACCACGGGCTATGTGACCTTAGG + Intronic
910908521 1:92209048-92209070 GCCTTGGGCTCTGTTTTCTGTGG - Intergenic
912344625 1:108953155-108953177 GCCCAGGGCTTTGTCATCTTGGG - Intronic
914453129 1:147811099-147811121 GCCCTGTGCTGTTTGATCTTGGG - Intergenic
915348612 1:155211054-155211076 GCCATTGACTATGTGATCTCGGG + Intronic
915351802 1:155231682-155231704 GCCATTGACTGCGTGATCTTGGG + Intergenic
917542332 1:175926494-175926516 GCCAGGGGCTCTCTGGACTTTGG - Intergenic
918381207 1:183957281-183957303 TCTATCAGCTCTGTGATCTTGGG - Intronic
918570717 1:185988736-185988758 CTGATGGGCTTTGTGATCTTGGG + Intronic
919585641 1:199436107-199436129 GACATGGGCTCTGCAATCTCAGG + Intergenic
919713238 1:200749331-200749353 GCCATGGGCATTGTGTTCCTTGG + Intronic
920334029 1:205232149-205232171 GCCCTGGGATCTGTGATTATAGG + Intronic
920779773 1:208977629-208977651 GCTATGGATTCTGTGATGTTGGG + Intergenic
921403859 1:214757489-214757511 ACCCTGGCCTCTGTGTTCTTAGG - Intergenic
922553855 1:226518234-226518256 GCTATGGGCTATGTGGTCTTAGG + Intergenic
922882108 1:228988929-228988951 GCCATGGTCTCTGTGAACCCTGG + Intergenic
922883955 1:229003771-229003793 GCCCCGGGCTCTGTGACCTCAGG - Intergenic
924135085 1:240957309-240957331 GCCAGGGGCTCTCAGGTCTTCGG + Intronic
924306890 1:242698708-242698730 GCCAGGGGCTCTGGGGCCTTTGG - Intergenic
924845967 1:247771533-247771555 GCAATGTGCTTTGTGATGTTCGG - Intergenic
1062833472 10:621591-621613 GCGATGGGCACTGAGGTCTTGGG + Intronic
1063345207 10:5305709-5305731 GTCATTCGCTGTGTGATCTTGGG - Intergenic
1063702625 10:8400319-8400341 GCCCTTTGCTCTGTCATCTTCGG + Intergenic
1064086910 10:12351795-12351817 GCCATGTTCCCTGTGAGCTTTGG + Intronic
1064729930 10:18319903-18319925 GCCCTGGCCTCTCTGTTCTTGGG - Intronic
1065226865 10:23552427-23552449 GCCAGGGGCTCTCAGACCTTTGG + Intergenic
1069910920 10:71758632-71758654 ACCCTGGGCTATGTGAGCTTGGG + Intronic
1070366578 10:75742649-75742671 GCCAAGGGCCCTCTGCTCTTGGG + Intronic
1070399516 10:76040981-76041003 GCCATTTGCTGTGTCATCTTAGG + Intronic
1070736373 10:78866308-78866330 GGCCAGGGCTCTGTGACCTTTGG + Intergenic
1070812821 10:79306808-79306830 CCCCTGGGATCCGTGATCTTAGG + Intronic
1071138269 10:82477495-82477517 GGCATGGGCTCTGAGGTCTTTGG - Intronic
1071281277 10:84106297-84106319 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1071308854 10:84324792-84324814 GCCAGGGGCTCTTGGACCTTTGG + Intergenic
1071333746 10:84585344-84585366 GCCTTTGGCTCTGTGCTCCTTGG - Intergenic
1071722883 10:88165010-88165032 GTTATGAGCTCTGAGATCTTGGG + Intergenic
1074120259 10:110488761-110488783 GCCATGAGCTGTGTAAGCTTAGG - Intergenic
1074330854 10:112507581-112507603 GCTAAGTGCTCTGAGATCTTGGG - Intronic
1074441870 10:113484752-113484774 GGCATGGGCTCTTTGAAATTCGG - Intergenic
1074954086 10:118370412-118370434 CTTATGAGCTCTGTGATCTTGGG - Intergenic
1075050269 10:119178452-119178474 GCCACCGACCCTGTGATCTTGGG - Intronic
1075585926 10:123658193-123658215 GCCAGGGGCTCTCAGACCTTTGG - Intergenic
1075834559 10:125442764-125442786 GTCATTAGCTCTGTGAACTTGGG + Intergenic
1076368963 10:129939739-129939761 GCCATTGACTCTGGGATCTCTGG - Intronic
1076549902 10:131271550-131271572 GTCATGGGCTCTGGGACCTGAGG + Intronic
1078581346 11:12541847-12541869 TCAACGGGCTCTGTGACCTTGGG - Intergenic
1078822561 11:14896418-14896440 GCCATGGTCCCTGTGTTCCTGGG + Intergenic
1080244274 11:30162203-30162225 GCCATGGACTCAGTGACCTAGGG + Intergenic
1081521918 11:43890020-43890042 GCCATGTTCTCTCTGATCTCTGG - Intronic
1083087926 11:60169211-60169233 GCCAAGGGCTCACTCATCTTGGG + Intergenic
1083293905 11:61705064-61705086 GCCCTGGGCTCTGTGAACACAGG - Intronic
1084738361 11:71120837-71120859 GCCATGGGCTCTGTGGATGTTGG - Intronic
1084912555 11:72402735-72402757 GTCATTGGCTTTGTGACCTTAGG - Intronic
1085058594 11:73424150-73424172 GCTGTGGGCTGTGTGATCTTGGG - Intronic
1085916031 11:80889082-80889104 GCAATGGGGTTTGTGAGCTTTGG + Intergenic
1087415563 11:97851068-97851090 GCCAGGGGCTCTCAGGTCTTTGG + Intergenic
1089159533 11:116426924-116426946 GCCAATTGCTGTGTGATCTTAGG + Intergenic
1089371020 11:117957681-117957703 GCCAGGGGCTCTCGGACCTTTGG - Intergenic
1089408356 11:118217780-118217802 GCCACTTGCTCTGTGTTCTTAGG - Intronic
1090170166 11:124594878-124594900 TCCATTAGCTCTGTGACCTTGGG + Intergenic
1091097878 11:132840970-132840992 CTCAGGGGCTGTGTGATCTTAGG + Intronic
1091278049 11:134365452-134365474 GCCCTGTGCTGTGTGACCTTGGG + Intronic
1093247858 12:16762243-16762265 GACATGGGCACTGTGATACTGGG - Intergenic
1095102927 12:38202163-38202185 GCCATGGACTCTGTGCGCTCGGG + Intergenic
1096457113 12:51796750-51796772 GCCAGGGGCTCTCTGGCCTTTGG - Intronic
1096816311 12:54203940-54203962 GCCAGGGGCTCAGAGATCATGGG - Intergenic
1098602204 12:72345661-72345683 GTCATGGGATTTGTGTTCTTGGG + Intronic
1100203764 12:92326409-92326431 GCCAGGGGCTCTCAGACCTTTGG - Intergenic
1101192632 12:102351004-102351026 GCCAGGGGCTCTGAGGCCTTTGG - Intergenic
1101842056 12:108334738-108334760 GCTATGAGCTGTGTGACCTTAGG + Intronic
1101970081 12:109306909-109306931 GCCCTTGGCTGTGTGATCTTGGG + Intronic
1102031938 12:109744614-109744636 CCCATGAGCTGTGTGGTCTTGGG + Intronic
1102394106 12:112573759-112573781 GCAATGGCCTCTGTGATTTGGGG + Intronic
1103118957 12:118364441-118364463 ACCATGGTCTCTGTGACCTTTGG + Intronic
1103749744 12:123150766-123150788 GCCGCGGGCTCTGTCCTCTTCGG + Intergenic
1104063347 12:125286197-125286219 GCTACTGGCTGTGTGATCTTGGG - Intronic
1104359748 12:128121453-128121475 CTCATGAGCTCTGTGATCTTGGG + Intergenic
1104931371 12:132341144-132341166 GACATGGGCTCTGAGCACTTGGG + Intergenic
1106075782 13:26459718-26459740 GCCAAGGGCTCTGTGGTCCCAGG - Intergenic
1106380937 13:29238459-29238481 GCCAGGGGCTCTTGGACCTTTGG - Intronic
1106876344 13:34078013-34078035 TCCATGACCTCTGTGATCTTGGG - Intergenic
1108434412 13:50387516-50387538 ACCGTGGCCACTGTGATCTTAGG - Intronic
1110294738 13:73850867-73850889 GCCATGAGCTATGTAATGTTAGG - Intronic
1110697652 13:78510494-78510516 GACAGGGGCTCTGTGCTATTCGG - Intergenic
1111044549 13:82797283-82797305 GCCAGGGCCTCTCAGATCTTTGG + Intergenic
1111440619 13:88279425-88279447 GCCAGGGGCTCTTGGGTCTTTGG + Intergenic
1111891571 13:94088841-94088863 GTGATGGTCTCAGTGATCTTGGG + Intronic
1112206093 13:97324748-97324770 GCCAGGGGCTCTCGGACCTTTGG - Intronic
1113111963 13:106832766-106832788 GCCATTTGCTCAGTGATATTAGG + Intergenic
1113181266 13:107630330-107630352 ACCATGGGGTCTGTGACTTTAGG + Intronic
1113445782 13:110365513-110365535 ACAAAGGGCTCTGTGACCTTGGG + Intronic
1115161381 14:30399500-30399522 GCCAGGGGCTCTAGGGTCTTTGG - Intergenic
1116250376 14:42474320-42474342 GCCAAGGGCTCTCGGGTCTTTGG - Intergenic
1118302174 14:64625717-64625739 GCGGTGAGCTCTGTGACCTTGGG + Intergenic
1119193500 14:72700719-72700741 GCTGTTGACTCTGTGATCTTGGG + Intronic
1119558534 14:75571659-75571681 CCCATGGGCTCTGTGAGGTGTGG + Intergenic
1119769126 14:77209516-77209538 TCCATGGGCTCTTTGATAGTAGG - Intronic
1120969793 14:90197843-90197865 GCCATGGGCTCTTTCATCCTGGG - Intergenic
1121036031 14:90704410-90704432 GCTGTGGGCTGTGTGATCATGGG - Intronic
1121446079 14:93980161-93980183 GCCCTGGCCTCAGTGATCTCTGG + Intergenic
1122615399 14:103014216-103014238 GCCTTGTGCTCTGTGTTCCTGGG - Intronic
1122813850 14:104302552-104302574 CCCATGAGCTGTGTGACCTTGGG + Intergenic
1123184610 14:106504935-106504957 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1123462225 15:20483482-20483504 GAGATGGGCTCTGTGGTCTGTGG - Intergenic
1123655833 15:22516889-22516911 GAGATGGGCTCTGTGGTCTGTGG + Intergenic
1123941815 15:25220331-25220353 GCCCTGGGCCCTCTGTTCTTGGG + Intergenic
1124272911 15:28299481-28299503 GAGATGGGCTCTGTGGTCTGTGG - Exonic
1124309742 15:28612072-28612094 GAGATGGGCTCTGTGGTCTGTGG + Intergenic
1124681008 15:31730786-31730808 GCCGTGGGCTCAGTGCTCTGGGG - Intronic
1125592535 15:40863871-40863893 GCCACTGGCTGTGTGACCTTGGG - Intergenic
1125621594 15:41067765-41067787 GACATGATCTCTGTGATTTTGGG - Intronic
1127850810 15:62910360-62910382 GGGTGGGGCTCTGTGATCTTAGG - Intergenic
1128216549 15:65938260-65938282 TGCATTGGCTGTGTGATCTTGGG - Intronic
1129144622 15:73635381-73635403 TCCAGGAGCTCTGTCATCTTAGG + Intergenic
1129512978 15:76138528-76138550 CTTATGGGCTCTGTGACCTTGGG - Intronic
1131066425 15:89437462-89437484 GCCCTGAGCTATGTGACCTTGGG - Intergenic
1132089152 15:98933744-98933766 GGCCTGGGCTCTGTGAACTCAGG - Intronic
1132567701 16:630891-630913 GCCAGTGGCTCTGTGCTCATGGG + Intronic
1133680860 16:8118575-8118597 GCCAGGGGCTCTTGGGTCTTCGG - Intergenic
1134139574 16:11706379-11706401 GCCCTGGGCCCTGTGATCGTCGG + Intronic
1134749193 16:16612383-16612405 GCCAGGGGCTCTCGGACCTTAGG + Intergenic
1134996276 16:18741260-18741282 GCCAGGGGCTCTCGGACCTTAGG - Intergenic
1135149761 16:19995183-19995205 GCCATGGGCTCTCACATCCTGGG + Intergenic
1135858732 16:26035786-26035808 GCCATTGACTCTGTGTTCCTGGG + Intronic
1136374087 16:29854846-29854868 GCCAAGGGCTCTGTCCTCTGGGG + Intergenic
1136555540 16:31005708-31005730 CCCATCAGCTGTGTGATCTTGGG - Intronic
1136748485 16:32613054-32613076 TCCCTGGGCTCTGTGAACTCAGG - Intergenic
1137340955 16:47603947-47603969 GTCATGAGCTCTGTAACCTTGGG - Intronic
1138618046 16:58187795-58187817 GCCATGGGCTCTGTGATCTTGGG - Intronic
1138627902 16:58266941-58266963 CCCCTGGTCTCTGTGACCTTGGG + Intronic
1139270024 16:65673211-65673233 GCCATGAGCATTGTGATCCTTGG - Intergenic
1139921923 16:70466082-70466104 GCCTTGGGCTCTGTGCACTGAGG + Intronic
1140471404 16:75217350-75217372 GCCTTGGGCTCTGTGGTCAGCGG - Intergenic
1140540434 16:75751861-75751883 GCCATGGGTTCTCAGGTCTTTGG + Intronic
1140693681 16:77510190-77510212 GCCAAGAGCTCTTTGATCATGGG - Intergenic
1141721765 16:85759875-85759897 GGCATGGGCAGTGTGATCCTCGG + Intergenic
1142033681 16:87851056-87851078 GTCTTGTGCTGTGTGATCTTGGG - Intronic
1142049597 16:87949771-87949793 GTCATGGGCTATGCGACCTTGGG - Intronic
1142142963 16:88480701-88480723 GCCCCTGGCTCTGTGACCTTGGG - Intronic
1203050619 16_KI270728v1_random:872259-872281 TCCCTGGGCTCTGTGAACTCAGG - Intergenic
1143033152 17:3979103-3979125 GTTATGAGCTGTGTGATCTTGGG + Intergenic
1144080395 17:11758922-11758944 CCCATGGGCTCTGTGGCCTTGGG + Intronic
1147218302 17:38913467-38913489 GCTCTGGAATCTGTGATCTTGGG + Intronic
1149095744 17:52838348-52838370 GCCAGAGGCTCTCAGATCTTCGG - Intergenic
1152612581 17:81322935-81322957 GCAGAGGGCGCTGTGATCTTTGG - Intronic
1155636349 18:27960213-27960235 ACCATGGGATCTGTGATCTGAGG + Intronic
1156187405 18:34678717-34678739 GCCATAGGGTCAGGGATCTTGGG + Intronic
1156931985 18:42656366-42656388 TCCCTGGGTTCTTTGATCTTTGG + Intergenic
1157426359 18:47587715-47587737 GCCCTGGGCTGTGTGACTTTGGG - Intergenic
1157435925 18:47669157-47669179 GGCATGGGCAGTGTGATCTGAGG + Intergenic
1157814561 18:50721412-50721434 CACATGGCCTCTGTGATCCTTGG - Intronic
1158418305 18:57269606-57269628 ACCAGCAGCTCTGTGATCTTGGG - Intergenic
1158641788 18:59209927-59209949 GCCATTTACTGTGTGATCTTGGG - Intergenic
1158818105 18:61127260-61127282 GCCAGGGGCTCTCAGACCTTTGG - Intergenic
1160126644 18:76179921-76179943 GCCAGGGGCTCTTAGACCTTGGG - Intergenic
1160167674 18:76528693-76528715 GCCACTGGCTCTGTGTCCTTGGG + Intergenic
1161173063 19:2822972-2822994 GCCAAGGGCTCTGGGATCTGGGG + Intronic
1163057552 19:14731989-14732011 GCAATGGACTCTGTGGTCTGGGG - Intronic
1165276846 19:34760523-34760545 GCAGTAGGCTCTGTAATCTTGGG + Exonic
1165946973 19:39449458-39449480 GCCTTGGGCTGGGTGATGTTGGG + Intronic
1166343048 19:42150209-42150231 GCCATGGGATGGGTGGTCTTGGG - Intronic
1167106854 19:47435452-47435474 GCAAGGGGCTCTTTGAGCTTCGG - Intronic
1168136414 19:54355305-54355327 GCCATGGGCTTTGTGGACTGTGG + Exonic
925296119 2:2778771-2778793 GCCACAGGCTCTGTGCTCTGTGG + Intergenic
926577781 2:14601231-14601253 GCCAGGGGCTCTCTGGCCTTCGG + Intergenic
926715269 2:15919295-15919317 GTCATGGGCTCAGGGCTCTTTGG - Intergenic
928596441 2:32863488-32863510 CCCAGGGGCTGTGTGATTTTAGG + Intergenic
931155036 2:59618539-59618561 GCCATGCCCTCTGTGTTCTCAGG + Intergenic
931707867 2:64962453-64962475 GCCAGGGGCTCTCAGGTCTTAGG - Intergenic
932905012 2:75739603-75739625 GCCAGGGGCTCTTGGGTCTTTGG + Intergenic
933813070 2:86045056-86045078 ACCAAGGGCTCTGTGTTCTGAGG - Intronic
938343260 2:130549261-130549283 GCCATGGGCTGTGTGCTCCCGGG - Intronic
938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG + Intronic
939974172 2:148697100-148697122 ACCCTGGGCTCTTTAATCTTAGG - Intronic
940712318 2:157177136-157177158 GCCATGGGATCTGAGTGCTTTGG - Intergenic
941036352 2:160573075-160573097 GCCATGGGCTCTTAGGCCTTTGG + Intergenic
941081104 2:161061527-161061549 GCCAGGGGCTCTTGGACCTTTGG + Intergenic
941908658 2:170741271-170741293 GCCTCGGGCTCTGTGTTCTAGGG + Intergenic
942636449 2:178011853-178011875 GCCATGGCCTCAGTAACCTTGGG - Intronic
943627004 2:190212654-190212676 GCGATGGTCTCTGTGACCTTGGG - Intronic
943988461 2:194654903-194654925 CCCATGGGTTCTGTGTTCTGGGG - Intergenic
947791612 2:232872171-232872193 GCCCTGGGCTCTGTGGGCTGGGG + Intronic
948052061 2:234986150-234986172 ACCATGGTCTCTGTGCTCATAGG - Intronic
948552749 2:238785557-238785579 GCGATTTGCTGTGTGATCTTAGG - Intergenic
1169140160 20:3223255-3223277 TCCTTGGGGTCTGTGAGCTTTGG + Intronic
1169939051 20:10917235-10917257 GTCATGGGCTGTATGATTTTAGG - Intergenic
1170121443 20:12916837-12916859 GCCCTGGGCCCTGTGAACTGTGG + Intergenic
1172149523 20:32780228-32780250 GCCATGGGCTCTGTGTTCTCAGG - Intronic
1172149728 20:32781153-32781175 GCCCAGGGCTCTGTTGTCTTAGG + Intronic
1172762334 20:37331596-37331618 GACCTGGGCTCTGTGGCCTTGGG + Intergenic
1173397825 20:42696789-42696811 GCCAGGAGCTCTGCGAGCTTGGG + Intronic
1173625633 20:44470839-44470861 GTCACTGGCTGTGTGATCTTGGG - Intergenic
1174272891 20:49382165-49382187 GCAATGGGCTGTGTGACCGTGGG - Intronic
1174480668 20:50829015-50829037 ACCATGAGCTCTGTGACCTTGGG - Intronic
1174933908 20:54846334-54846356 GCCAGGGGCTCTCGGATTTTTGG - Intergenic
1175247547 20:57590956-57590978 GCCTTGGGGTCTGTGATCCCAGG - Intergenic
1175384290 20:58584310-58584332 GCCCTGGGCTGTGTGACCTCAGG + Intergenic
1175484781 20:59338118-59338140 GTGATGGGCTATGTGACCTTGGG + Intergenic
1175505045 20:59476583-59476605 CCCTTGGGCTCAGTGATTTTGGG - Intergenic
1176102473 20:63370780-63370802 GCCCTTGGCTCTGTCATCATGGG - Intronic
1176386049 21:6138967-6138989 GTCTTGGGCTCTGTGAGCTCGGG + Intergenic
1178055605 21:28795305-28795327 GTTATTGGCTCTGTGATATTGGG - Intergenic
1178127769 21:29534026-29534048 ACCATGGCCTCTCTGATGTTGGG + Intronic
1179737424 21:43399285-43399307 GTCTTGGGCTCTGTGAGCTCGGG - Intergenic
1180051624 21:45334211-45334233 GCCATGGTTTCTGTGACCTGTGG + Intergenic
1180169786 21:46052021-46052043 GCCAGGGGCTCTGTTCTCTGAGG - Intergenic
1180247154 21:46555652-46555674 GCCATAGGCTCTGTGACTTTTGG + Intronic
1180733104 22:17996692-17996714 GCCACGCACTCTGTCATCTTTGG - Intronic
1181004162 22:20001987-20002009 GCCCTGGGCTCTGTCTTCTGTGG - Intronic
1181286033 22:21753378-21753400 GCCCAGGGCTGTGTGGTCTTGGG + Intergenic
1181517796 22:23425683-23425705 GCCACGCACTCTGTCATCTTTGG - Intergenic
1181736647 22:24886740-24886762 GCCATGGGCACTGGGATCTTTGG + Intronic
1182102844 22:27670079-27670101 ACCTGGGGCTGTGTGATCTTGGG - Intergenic
1182512190 22:30827383-30827405 GCCAGAGGCTCTGTCATGTTAGG - Intronic
1182521469 22:30887101-30887123 GCCATGGCATCTGTGAACTGTGG + Intronic
949623908 3:5847179-5847201 TCAATGCACTCTGTGATCTTTGG + Intergenic
949715220 3:6922159-6922181 AGCATGGGCTATGTGATCTGAGG - Intronic
949822991 3:8136142-8136164 TTCATGAGCTGTGTGATCTTGGG - Intergenic
950126989 3:10515698-10515720 TCACTGAGCTCTGTGATCTTGGG + Intronic
950159410 3:10748592-10748614 CCCATTAGCTGTGTGATCTTGGG - Intergenic
950174852 3:10865953-10865975 CCAATTGCCTCTGTGATCTTGGG - Intronic
950629862 3:14275182-14275204 GCTATTGGCTGTGTGACCTTGGG + Intergenic
951550812 3:23873383-23873405 GCCATGGGGTCTCTCATCCTAGG - Intronic
951590471 3:24258997-24259019 GCTAGTGGCTCTGTGACCTTGGG - Intronic
954746912 3:52792612-52792634 GCTAGGGGCTCTGTGTTCATAGG - Intergenic
955000586 3:54923766-54923788 GGCTTCTGCTCTGTGATCTTGGG + Intronic
955221878 3:57029790-57029812 ACCTTGGGCTCTGTGACCCTGGG - Intronic
955573463 3:60332320-60332342 GCCAGAGGCTCAGTCATCTTGGG - Intronic
956199996 3:66695946-66695968 ACCATGGGCTCTGTAATCCTAGG + Intergenic
956900475 3:73710501-73710523 GTCATGGGCTTTGTGTTCTGTGG + Intergenic
957287904 3:78240782-78240804 GACAAGGGCTATGTGATCCTGGG - Intergenic
958013662 3:87913839-87913861 GCCATGATCCCTGTGATATTTGG - Intergenic
964430246 3:156598153-156598175 GCCATCACCTCTGTGACCTTGGG - Intergenic
965478576 3:169187835-169187857 GCCAGGGTCTCTGTTAACTTGGG + Intronic
966238968 3:177733853-177733875 GCCATTTGCTGTGTGATCATTGG - Intergenic
966916501 3:184587245-184587267 GGGACTGGCTCTGTGATCTTCGG - Intronic
966938798 3:184732073-184732095 AGCATGGGCTGTGTGAGCTTGGG + Intergenic
968856796 4:3131121-3131143 GCCATGGTCTCTGTGAGGTCAGG + Intronic
969865576 4:10075053-10075075 GCCAGGGGCTCTGTGTGCTTTGG + Exonic
970109363 4:12620168-12620190 GCCTGGGGCTCTGTGCTCCTGGG + Intergenic
971790738 4:31167275-31167297 GCCAGGGGCTCTCAGACCTTCGG - Intergenic
972338366 4:38128715-38128737 GTCCTGGGCTCTGTCACCTTTGG - Intronic
974066196 4:57079984-57080006 CCCATGTGCTCTGTGATTCTGGG - Intronic
976498840 4:85762643-85762665 CTCATGGGCTATGTGACCTTGGG - Intronic
976688427 4:87842088-87842110 TTTATGGGCTGTGTGATCTTGGG - Intronic
976871649 4:89801104-89801126 GACTTGAGCTGTGTGATCTTTGG - Intronic
977035097 4:91940880-91940902 GCCATGAGCTCTCGGGTCTTTGG - Intergenic
980386676 4:132093993-132094015 GCCATGGGCTCTCTGGCCTTTGG - Intergenic
981153752 4:141409683-141409705 GCCATGGTTTCTGTACTCTTAGG + Intergenic
981213764 4:142138639-142138661 CCCACTAGCTCTGTGATCTTAGG + Intronic
981220359 4:142225280-142225302 GCCAGGGGCTCTCTGGCCTTTGG + Intronic
981519028 4:145641705-145641727 CCCACGAGCTATGTGATCTTGGG - Intronic
982481843 4:155921725-155921747 GCCATGGGCTCTGGGGCCTTCGG - Intergenic
982492321 4:156044708-156044730 GCCAGGGGCTCTTGGGTCTTTGG - Intergenic
982529847 4:156525938-156525960 ACCATAGGCTGTGTGAGCTTTGG - Intergenic
983582795 4:169325633-169325655 ACCATGGGCACTTTGTTCTTGGG - Intergenic
983696532 4:170539513-170539535 TGAATGGGCTCTGTGATCTTGGG - Intergenic
986315491 5:6583701-6583723 GCCCTGGGTTCTGGGACCTTTGG + Intergenic
989356988 5:40554593-40554615 TCCCTGAGCTCTTTGATCTTGGG - Intergenic
989684710 5:44071908-44071930 GCCATTTGCTATGTGATCTTGGG - Intergenic
990648655 5:57873200-57873222 GCAATGGACTCTGTGACCTTGGG + Intergenic
992403967 5:76438211-76438233 GCCCTGGGCTCTTTTTTCTTTGG + Intronic
992988340 5:82257039-82257061 GCCAAGCGCTCTCTGATCTGGGG + Intronic
994021338 5:95029590-95029612 TCCATGGGGTCTGAGTTCTTTGG - Intronic
995321419 5:110838334-110838356 GCCAGGGGCTCTTGGGTCTTTGG - Intergenic
995367628 5:111381399-111381421 GCCAGGGGCTCTTGGGTCTTTGG - Intronic
997739442 5:136240738-136240760 CTCATTGGCTCTATGATCTTGGG + Intronic
997845393 5:137281560-137281582 GCCATGGGCTATGTGTTGGTGGG - Intronic
998145976 5:139728623-139728645 CATATTGGCTCTGTGATCTTGGG + Intergenic
998507848 5:142686369-142686391 GCCAATGGCTCTGTGTTCCTGGG - Intronic
999659970 5:153850816-153850838 GCCATGGGCTTTCTGGCCTTTGG - Intergenic
1001042074 5:168343417-168343439 AACCTGAGCTCTGTGATCTTGGG - Intronic
1001934090 5:175692429-175692451 GCCCCTGGCTCTGTGACCTTGGG + Intergenic
1001950045 5:175810033-175810055 GCCATGAGGTCTGTGATGCTGGG - Intronic
1001990356 5:176111443-176111465 TCCCTGGGCTCTGTGAACTCAGG - Intronic
1002226515 5:177726697-177726719 TCCCTGGGCTCTGTGAACTCAGG + Intronic
1002267332 5:178044516-178044538 TCCCTGGGCTCTGTGAACTCAGG - Intronic
1003011567 6:2432150-2432172 GCCATGGAGTCTGTACTCTTTGG - Intergenic
1003725339 6:8755886-8755908 CCCATCAGCTTTGTGATCTTTGG + Intergenic
1005265674 6:24109778-24109800 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1005704226 6:28435635-28435657 GCCATGTTCTCTCTGATATTGGG - Intronic
1006402557 6:33826252-33826274 TGGATGGGCTCTGTGACCTTGGG - Intergenic
1007293510 6:40804293-40804315 GAAATGTGCTGTGTGATCTTGGG - Intergenic
1007600541 6:43078035-43078057 GCCAGGGGGCCTGTGAGCTTGGG - Intronic
1008668951 6:53746976-53746998 GCTGTGTGCTCTGTGATCTTGGG + Intergenic
1010231306 6:73537831-73537853 GTCACGAGTTCTGTGATCTTGGG + Intergenic
1011186593 6:84683558-84683580 GCCAGGGGCTCAGGGACCTTTGG + Intergenic
1011282236 6:85688669-85688691 GCCATGGTGTCTATGAGCTTAGG - Intergenic
1011868878 6:91867430-91867452 GATATGATCTCTGTGATCTTAGG - Intergenic
1012736890 6:102959209-102959231 GCCAGGGGCTCTCTGGCCTTAGG + Intergenic
1013610312 6:111788558-111788580 GCCATGGGCACAGAGAGCTTTGG - Intronic
1014073223 6:117207113-117207135 TCCCAGGGCTCTGTCATCTTTGG - Intergenic
1015022060 6:128488117-128488139 GCCAGGGGCTCTCAGATCTGTGG - Intronic
1015755487 6:136601936-136601958 GACATGGACTCTGGGATCTCAGG + Exonic
1016426481 6:143941512-143941534 GCCATGGGCACTGTGAGCCTGGG - Exonic
1017862949 6:158415993-158416015 GCCAGGGGCTCTTGGACCTTCGG - Intronic
1018666766 6:166145751-166145773 GCCAGGGGCTCTTGGACCTTTGG + Intergenic
1018885470 6:167931914-167931936 GCCATGGGCTCCGTGCTCCAAGG - Intronic
1020035869 7:4962805-4962827 CCCATAGGCCCTGTGACCTTGGG - Intergenic
1021902831 7:25304446-25304468 TTTATGAGCTCTGTGATCTTGGG + Intergenic
1022872302 7:34492305-34492327 GCCATGGTCTATGTGACCCTTGG + Intergenic
1023535301 7:41202603-41202625 GCCATGGTGTCTTTGATCCTTGG + Intergenic
1024468305 7:49738077-49738099 GCCAGGGGCTCTATGGCCTTTGG + Intergenic
1025184730 7:56848872-56848894 GCCATAGGCCCTGCGAGCTTAGG - Intergenic
1025687200 7:63728090-63728112 GCCATAGGCCCTGCGAGCTTAGG + Intergenic
1027996103 7:85427122-85427144 GCCATGGGCCTTGTGCTCTAAGG + Intergenic
1030037682 7:105421917-105421939 GCCAAGGGCTCTCGGACCTTTGG - Intergenic
1030322521 7:108183994-108184016 GCCACTAACTCTGTGATCTTAGG - Intronic
1032325708 7:130926538-130926560 GCCCTGCGCTGTGTGAGCTTGGG - Intergenic
1034171302 7:149065467-149065489 GCCCTGGGCTCTGCGGTCTTTGG - Intergenic
1034844536 7:154431938-154431960 GCCCTGGGCTCTGTGGTTTCAGG + Intronic
1035279332 7:157767371-157767393 GCCATGTTATCTGTGTTCTTAGG + Intronic
1035321525 7:158032691-158032713 GCCTGGTGCTCTGTGATTTTAGG - Intronic
1036010453 8:4716001-4716023 GCCCTGGCCCCTGTGCTCTTTGG - Intronic
1036587198 8:10135226-10135248 GCCATGCCCTCTGTGACATTGGG + Intronic
1037980734 8:23251516-23251538 GCCATGGGCCCTGGGACCCTGGG + Intronic
1038083378 8:24165427-24165449 TCCAGGGGCTCTTGGATCTTTGG - Intergenic
1038694278 8:29792304-29792326 CCCATGGGAGCTGTGATCTCAGG - Intergenic
1042191596 8:66192828-66192850 GCCAGGGGCTCTTAGATCTTCGG + Intergenic
1044562563 8:93627368-93627390 GCCTTGAGCTCTGAAATCTTTGG - Intergenic
1046066703 8:109205738-109205760 GCCATGGGCTCTCAGGCCTTTGG - Intergenic
1046089113 8:109477712-109477734 TCAGTGAGCTCTGTGATCTTAGG - Intronic
1047572346 8:126113142-126113164 GCTGTGTGATCTGTGATCTTGGG + Intergenic
1048493108 8:134912910-134912932 GCCTTGAGCTCTGTGTTCTGTGG - Intergenic
1049255957 8:141614013-141614035 CCCATGAGCTGTGTGATCATGGG + Intergenic
1049305574 8:141901709-141901731 GCCAGGGGCTCTGGGGCCTTCGG + Intergenic
1049419059 8:142508893-142508915 GCTCTGGGCTCTGTGACCCTGGG - Intronic
1049433563 8:142576155-142576177 GTCCTGGGCTCTGTGTTCTAAGG - Intergenic
1049541253 8:143210217-143210239 GCCATGGGCTCTGCTGTCCTGGG - Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1052345873 9:27408850-27408872 GCCATGGGTTCAGGGATCTGGGG - Intronic
1052889145 9:33680934-33680956 GCCAGGGGCTCTTGGACCTTCGG + Intergenic
1054751817 9:68915174-68915196 AGCATGGACTCTGTGACCTTAGG - Intronic
1056435441 9:86571251-86571273 GCCAGGGGCTCTCAGACCTTTGG + Intergenic
1056786732 9:89597889-89597911 ACCATTGGCTGTGTGACCTTGGG + Intergenic
1056845034 9:90030297-90030319 CCCAAGCGCTCTGTGGTCTTGGG - Intergenic
1057879607 9:98783174-98783196 TCCATGGGGTCAGTGATTTTTGG - Intronic
1059545479 9:115171633-115171655 GCCATCAGCTGTGTGACCTTAGG + Intronic
1060074893 9:120582202-120582224 GCCACCAACTCTGTGATCTTTGG + Intergenic
1061234821 9:129336313-129336335 CCCAAGAGCTGTGTGATCTTGGG - Intergenic
1061777152 9:132973204-132973226 GGCATCGGCTGTGTGAACTTGGG - Intronic
1062355319 9:136159262-136159284 GCCAAGGGCTCTGTGATTCAAGG + Intergenic
1062434464 9:136540667-136540689 GCCACTAGCTCTGTGACCTTGGG - Intronic
1062725531 9:138071340-138071362 GCCATGGACTCAGTGAGGTTGGG + Intronic
1185608850 X:1382331-1382353 GACGTGGGCTCTGTTATCTGGGG + Intronic
1186267797 X:7850649-7850671 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1187391762 X:18890826-18890848 GCCAGTGCCTCTGTGATCCTGGG - Intergenic
1190711339 X:53072900-53072922 GTCATGGGCTCTGAGATTTCAGG + Intronic
1191885246 X:65881417-65881439 GTGATGGGCTGTGTGACCTTGGG - Intergenic
1194435982 X:93868878-93868900 CCCATGGGCTCGGGGCTCTTTGG + Intergenic
1194918356 X:99732280-99732302 CCTATGGGCTCTGTGTCCTTAGG + Intergenic
1196188593 X:112771560-112771582 GCCATGGGCACAGTGAGCTGAGG + Intergenic
1197419098 X:126215712-126215734 GCCATAGGCTCTTTGATTTCAGG + Intergenic
1197655513 X:129112406-129112428 GCCATGGGCTATGTGACATCAGG + Intergenic
1199596923 X:149513362-149513384 GCCAGGGGCTATGAGACCTTGGG - Intronic
1200138942 X:153887945-153887967 GCCTTGAGCTCTGTGGGCTTTGG - Intronic
1201614021 Y:15875906-15875928 GCCATTGGCGCTATGATCTGTGG - Intergenic
1201616347 Y:15903874-15903896 GCCATTGGCGCTATGATCTGTGG + Intergenic
1201955841 Y:19621559-19621581 GCAAAGGGTTCTGAGATCTTGGG + Intergenic