ID: 1138623546

View in Genome Browser
Species Human (GRCh38)
Location 16:58231130-58231152
Sequence AGAGTTATCCACTTTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138623546_1138623547 17 Left 1138623546 16:58231130-58231152 CCTTCATCAAAGTGGATAACTCT No data
Right 1138623547 16:58231170-58231192 ATGAACGAAGCCAGTCACAAAGG 0: 1
1: 10
2: 101
3: 313
4: 725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138623546 Original CRISPR AGAGTTATCCACTTTGATGA AGG (reversed) Intergenic
No off target data available for this crispr