ID: 1138626375

View in Genome Browser
Species Human (GRCh38)
Location 16:58255191-58255213
Sequence AGCTGCTGGTACAAGTCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138626368_1138626375 -7 Left 1138626368 16:58255175-58255197 CCTAGAGCCCCCAGGAAGCTGCT 0: 1
1: 4
2: 14
3: 68
4: 390
Right 1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 74
1138626364_1138626375 7 Left 1138626364 16:58255161-58255183 CCGTGGCCGAAGGCCCTAGAGCC 0: 1
1: 0
2: 5
3: 17
4: 126
Right 1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 74
1138626365_1138626375 1 Left 1138626365 16:58255167-58255189 CCGAAGGCCCTAGAGCCCCCAGG 0: 1
1: 5
2: 28
3: 89
4: 516
Right 1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 74
1138626367_1138626375 -6 Left 1138626367 16:58255174-58255196 CCCTAGAGCCCCCAGGAAGCTGC 0: 1
1: 3
2: 9
3: 61
4: 307
Right 1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 74
1138626360_1138626375 27 Left 1138626360 16:58255141-58255163 CCAATGGTGCAGCCTTCGGTCCG 0: 1
1: 0
2: 6
3: 67
4: 484
Right 1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 74
1138626363_1138626375 15 Left 1138626363 16:58255153-58255175 CCTTCGGTCCGTGGCCGAAGGCC 0: 1
1: 2
2: 113
3: 602
4: 678
Right 1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138626375 Original CRISPR AGCTGCTGGTACAAGTCCGA GGG Intronic
902562617 1:17287093-17287115 ATCTGATGGTCCAACTCCGAGGG - Intergenic
907936559 1:59047070-59047092 AGCTACTGGCACAAGTCCTCTGG + Intergenic
917117440 1:171616588-171616610 AGCTGCTGGAACAGGTTTGAAGG + Intergenic
922492740 1:226031579-226031601 GGCTGCTGGTGCAAGTTCCAGGG + Intergenic
922636913 1:227182925-227182947 AGCTGCTGGTGCAAGTCCAAAGG - Intronic
1066750982 10:38656930-38656952 GGCTGCTGATGCAAGTCCCAGGG - Intergenic
1066966065 10:42266183-42266205 GGCTGCTGATGCAAGTCCCAGGG + Intergenic
1067218839 10:44326783-44326805 AGATGCAGGGACAAGTCCTATGG - Intergenic
1070951126 10:80431777-80431799 AGCTGCTGGTACAGGCCAGATGG + Intronic
1073195456 10:101687265-101687287 AGCTGTTGGGAGCAGTCCGAAGG - Intronic
1077138539 11:1013364-1013386 AGCTGCTGGCACAAGCGGGAAGG + Exonic
1079380678 11:19934546-19934568 AGCTGCTGCTACAAGGCCTGGGG - Intronic
1083161212 11:60855333-60855355 TGCTGCTGATCCAAGTCCTATGG + Intronic
1085381975 11:76128103-76128125 TGCTACTGGTACATGGCCGAGGG - Intronic
1086412368 11:86555354-86555376 AGCTGATGGTACATTTCTGAAGG - Intronic
1088059285 11:105626714-105626736 AACTGTTGGCACAAGTCAGATGG - Intronic
1088448191 11:109954641-109954663 AGAGGCTGGTGCAAGTCAGAAGG + Intergenic
1096371223 12:51070745-51070767 AGCTGCTGGAACAACCCCAAAGG + Intronic
1103154041 12:118667950-118667972 AGCAGCAGGGACAAGTCAGAGGG - Intergenic
1103238393 12:119393880-119393902 AGGTGCTGGTTAAAGTCTGATGG - Intronic
1104271000 12:127282194-127282216 AGCTGAAGGTACAAGTTTGAAGG - Intergenic
1110280874 13:73693156-73693178 AGGTGCTGGTACTAGTGCCAGGG + Exonic
1113662438 13:112116793-112116815 AGCTGATGGTCCAAGTCCAATGG - Intergenic
1129915375 15:79265518-79265540 AGCTGCTGTTTCAAGACCAAAGG - Intergenic
1131226454 15:90628355-90628377 ACCTGCTGGTACAAGAAAGATGG + Intronic
1136731742 16:32420181-32420203 GGCTGCTGATGCAAGTCCCAGGG + Intergenic
1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG + Intronic
1140900964 16:79367316-79367338 AGCTGCTGGTTGAAGTCACAGGG + Intergenic
1202994649 16_KI270728v1_random:97073-97095 GGCTGCTGATGCAAGTCCCAGGG - Intergenic
1203021336 16_KI270728v1_random:409415-409437 GGCTGCTGATGCAAGTCCCAGGG - Intergenic
1142718661 17:1762300-1762322 AGCTGGGGGGACAAGGCCGAAGG + Intronic
1147897129 17:43758156-43758178 AGCTGCTGGTACCACTGGGAAGG - Intronic
1148129925 17:45256494-45256516 AGCTTCTGTTACAAGGCAGAGGG - Intronic
1150971117 17:70029448-70029470 GGCTGCTGGTAAAAGTGCTATGG + Intergenic
1152976130 18:220511-220533 TGCTGCTGGTAGGAGTCTGATGG - Intronic
1157580888 18:48773577-48773599 AGCTTCTGGGACAAGTCAGTGGG + Intronic
1161241919 19:3227591-3227613 GGCTCCTGGTACAAGCCCGGAGG + Intronic
1164042186 19:21503565-21503587 AGCTGATGATACATGTCTGAAGG + Intronic
1164057832 19:21637121-21637143 AGCTGATGATACATGTCTGAAGG + Intergenic
1164307974 19:24021754-24021776 AGCTGATGATACATGTCTGAAGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
925194696 2:1913634-1913656 AGGTGCAGGTACATGTCAGAGGG - Intronic
934313977 2:91899088-91899110 GGCTGCTGATGCAAGTCCCAGGG - Intergenic
936714629 2:115171645-115171667 AGCTGCTGGTACAAAGCCTTCGG + Intronic
936971400 2:118179627-118179649 AGCTGCTAGTACACATCAGATGG + Intergenic
940310431 2:152273456-152273478 ACCTCCTGGTCCAAGTCCAAAGG - Intergenic
940389105 2:153110539-153110561 AGCTCCTGATCCAAGTCCAAAGG - Intergenic
942988197 2:182166466-182166488 GGCTGTTGGTACAAGTCTCAGGG - Intronic
1170127814 20:12985468-12985490 AGTTGCTTGTCCAAGTCCCATGG + Intergenic
1179583277 21:42358522-42358544 AGCTGCTGGTTCAGGGCTGAAGG + Intergenic
1180714817 22:17864684-17864706 AGGTGCTGGTGCAAATCAGAGGG - Intronic
1183628552 22:39019649-39019671 AGCTGCAGGTCCAACTTCGAGGG + Exonic
1184055283 22:42043414-42043436 AGCTGCTGGCACATGTGTGATGG + Intronic
949908333 3:8878124-8878146 AGATGCTGGTAGAAGTCTGTCGG + Exonic
950768367 3:15291023-15291045 AGCTCCCGGTAGAATTCCGAAGG - Intronic
962265901 3:133944106-133944128 AGCAGCAAGTACAAGTCCCAAGG - Intronic
969663734 4:8545161-8545183 AGCAGCTGGGAAAAGTCCTAAGG - Intergenic
971193855 4:24453283-24453305 AGCTGCTGTAACAAGTACCACGG - Intergenic
977463181 4:97351284-97351306 AACTCCTAGTACAAGTCCAAAGG + Intronic
980887517 4:138779438-138779460 AGCCGCTGGTGCAAGTCCCAGGG - Intergenic
981117046 4:141003874-141003896 AGCTGCTGGTACTATTCAGATGG - Intronic
984288817 4:177766857-177766879 AGCCACTGGTACAAGTCCTAGGG + Intronic
985614102 5:909251-909273 AGCTGCTGGCCCAACTCCCAAGG + Intronic
986403185 5:7398742-7398764 AGCTGCAGGACCAAGTCGGAAGG + Intronic
990739301 5:58895930-58895952 AGCTGCTGGTATATGTGGGAAGG - Intergenic
992259539 5:74956056-74956078 AGCTCATGGTTCAAGTCCAAAGG - Intergenic
995584729 5:113636458-113636480 AGCTGCTGGTGAAAGTCCCAGGG - Intergenic
1006114242 6:31766730-31766752 AGCTGCTGGTAGAAGTGACAGGG - Exonic
1012915371 6:105164603-105164625 TGCTGCTGGCACATGTCAGAAGG - Intronic
1015513905 6:134066169-134066191 ATCTGCTTGTCCAAGTTCGAGGG + Intergenic
1024382840 7:48719018-48719040 AGCCTCTGGTACAAGTCCCAGGG + Intergenic
1025801766 7:64793625-64793647 AGCTGATGATACATGTCTGAAGG + Intergenic
1026487767 7:70836117-70836139 AGCTGCTGGTAGAGGTAGGAAGG - Intergenic
1027124245 7:75544767-75544789 ATCTGGTGGTACAAGGCAGAGGG - Exonic
1028163698 7:87514215-87514237 GCCTGCTAGTACAAGTCAGATGG - Intronic
1037462933 8:19131433-19131455 AGGTGCTGGAACAAGTCGGTTGG + Intergenic
1042778898 8:72468098-72468120 AGCTGCTGCCACAAGACCTATGG - Intergenic
1044789623 8:95834361-95834383 AGCTGCTGGTCCCAGTAGGATGG - Intergenic
1047414669 8:124654210-124654232 AGCTGCTGATACAATCCTGAAGG + Intronic
1048021492 8:130543516-130543538 AGCCCCTGGTACAAGCCCCAAGG + Intergenic
1049460949 8:142727512-142727534 AGCAGCAGGTCCAAGTCCGAGGG - Exonic
1187333358 X:18360898-18360920 AGCTGCTGCTACCACTCCAAGGG + Intergenic
1191178542 X:57534315-57534337 GGCTACTGGTGCAAGTCCCAGGG - Intergenic
1201181888 Y:11356569-11356591 GGCTGCTGATGCAAGTCCCAGGG - Intergenic