ID: 1138627092

View in Genome Browser
Species Human (GRCh38)
Location 16:58261080-58261102
Sequence CTAGTTTACCAATTATTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138627092_1138627094 9 Left 1138627092 16:58261080-58261102 CCTTGAAATAATTGGTAAACTAG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1138627094 16:58261112-58261134 CGGAGAGCAAGCCAGATGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138627092 Original CRISPR CTAGTTTACCAATTATTTCA AGG (reversed) Intronic
904578294 1:31520653-31520675 CTAGTTTAACATTTATTTGGAGG + Intergenic
905506404 1:38483344-38483366 TTATTAAACCAATTATTTCACGG - Intergenic
905921481 1:41722336-41722358 CTAGTTTTCCACATATATCAGGG + Intronic
906984157 1:50664961-50664983 ATACTTTTCCAATTATTTAATGG + Intronic
907687800 1:56631214-56631236 CTTGTTTTAAAATTATTTCATGG + Intronic
908273738 1:62447364-62447386 CTAGTGGAGAAATTATTTCAAGG + Exonic
908409128 1:63845009-63845031 CTAGTGTAACAATGAATTCAAGG - Intronic
908756363 1:67472510-67472532 CTACTGTACCAATTTTGTCATGG + Intergenic
908805471 1:67926787-67926809 CTAGTTTAGAAGTTATTTAAAGG - Intergenic
909191696 1:72560340-72560362 TTAATTTACCAATTATTAGAGGG + Intergenic
909533219 1:76704232-76704254 AAAATTTTCCAATTATTTCAGGG - Intergenic
910174531 1:84414815-84414837 CAAATTTACCAAGCATTTCAAGG + Exonic
911463651 1:98223291-98223313 ATAGTTTAAAAATTATTTTAAGG - Intergenic
913490238 1:119372849-119372871 CTAGTTCAGCATTTACTTCATGG - Intronic
917483395 1:175432627-175432649 TCAGTTTTCCCATTATTTCAAGG + Intronic
917557377 1:176103851-176103873 TTATCTTACCAATTATCTCAGGG - Intronic
921338862 1:214114506-214114528 CTTGTTTCCCCATTCTTTCAAGG - Intergenic
923347444 1:233068332-233068354 ATTATTTACCTATTATTTCAGGG - Intronic
924907571 1:248472845-248472867 CCAGTTTTCAGATTATTTCATGG + Intergenic
924916539 1:248575243-248575265 CCAGTTTTCAGATTATTTCATGG - Intergenic
1063286599 10:4695199-4695221 CTAAATTTCAAATTATTTCATGG - Intergenic
1063537559 10:6899950-6899972 CTAGTGCTCAAATTATTTCAAGG - Intergenic
1064310356 10:14206957-14206979 CAAGATTACAAATTATTTTAAGG - Intronic
1065079210 10:22111168-22111190 CCATTTCCCCAATTATTTCATGG - Intergenic
1065425781 10:25602141-25602163 TAAATTTACCAAATATTTCATGG - Exonic
1065681438 10:28237751-28237773 CTATGTTACCACTTCTTTCAAGG + Intronic
1068358543 10:55944701-55944723 CTATTTAAACATTTATTTCATGG - Intergenic
1068933959 10:62618242-62618264 CTAGCTTTCCAATCATTGCAGGG - Intronic
1071801762 10:89071016-89071038 CTAGTTTATGAAATATTTTAAGG + Intergenic
1071998463 10:91170249-91170271 CCAGCTTATCAATTCTTTCATGG - Intronic
1072938572 10:99736851-99736873 CCAGTTTTTCATTTATTTCAGGG + Intronic
1074092102 10:110270583-110270605 CTAGTTTCTCATTTATTACATGG + Intronic
1074281224 10:112053429-112053451 CCACTATACCAATTATTTTATGG + Intergenic
1079062430 11:17261103-17261125 TCAGTTTTCCAAGTATTTCAGGG + Intronic
1079420491 11:20282442-20282464 CTAGTTTAAAAGTTATTTAAAGG - Intergenic
1080959674 11:37144268-37144290 GTAGTTTAACAAATATTTTAGGG + Intergenic
1081951486 11:47047597-47047619 TAAATTTAGCAATTATTTCATGG + Intronic
1083131503 11:60628327-60628349 GAAGTATACCAATTATTGCAAGG - Intergenic
1084392408 11:68886518-68886540 CTAGTTTACAGGTTATTTAAAGG - Intergenic
1085117291 11:73940948-73940970 CTGCTTTACAAATGATTTCAGGG - Intergenic
1086745213 11:90417158-90417180 CTGTTTTACAATTTATTTCAGGG - Intergenic
1087313634 11:96579685-96579707 CTGGTTCAGCAATAATTTCATGG + Intergenic
1087733182 11:101801498-101801520 TTGGTGTACCAATTATTTCGAGG - Intronic
1087918980 11:103844498-103844520 CCAGTTTACCAAGTCTTGCACGG + Intergenic
1089027296 11:115284462-115284484 CTACTTTACCAATTATTTAAAGG + Intronic
1089250024 11:117152308-117152330 TTAGTTTCCCAATTGTTTCTAGG + Intronic
1089424129 11:118356771-118356793 CTAGTTTCCCAAATATGTAAGGG - Intergenic
1090441391 11:126728177-126728199 CTGGTGTCCCAATTATTTCATGG - Intronic
1091117289 11:133025465-133025487 CTAGATTACCAAATAGTTAAGGG - Intronic
1093757119 12:22865106-22865128 TTCTTTTACCAATTATTTCTGGG - Intergenic
1094588989 12:31803515-31803537 ATAATTTACCAATTTTTTAAAGG + Intergenic
1096117422 12:49063139-49063161 CTAGTTTATCAATAATCTCAAGG - Intergenic
1097256282 12:57677640-57677662 CCAGCTTATCAATTCTTTCATGG - Intergenic
1097405880 12:59189424-59189446 TTAGTTTGCAATTTATTTCAAGG + Intergenic
1097633175 12:62089109-62089131 TTCGTTTAACAGTTATTTCAGGG - Intronic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1098089238 12:66883308-66883330 CTAGATTATAAATTATTTGAGGG + Intergenic
1099702980 12:86112712-86112734 CTAGTTCATTAATTATTTCATGG - Intronic
1100474971 12:94926771-94926793 CAAGTTTACAACTTAGTTCAGGG + Intronic
1101019850 12:100542882-100542904 CTAGTCTAACAAATATTTAAGGG + Intronic
1103391921 12:120580709-120580731 GTACTTTACCAACTATTTAAGGG + Intronic
1106976166 13:35218915-35218937 GAAGTTTACTAAATATTTCAGGG - Intronic
1108026182 13:46180450-46180472 CCAAATTACCAATTGTTTCAAGG + Intronic
1110054631 13:70951448-70951470 CTAATTTATAAATTATTTTAAGG - Intergenic
1110486331 13:76048930-76048952 GTAATTGACCAAATATTTCATGG - Intergenic
1110873638 13:80482430-80482452 CTAGATTACCATGTATTGCATGG + Intergenic
1111024066 13:82495333-82495355 CAAATTTGCCAATGATTTCATGG + Intergenic
1111121322 13:83854787-83854809 CAAGTGTGCCAATTATTTTAAGG - Intergenic
1113853625 13:113432016-113432038 ATATTTTAAAAATTATTTCACGG - Intronic
1116115511 14:40644900-40644922 TGAGATTACCAATTAATTCAGGG + Intergenic
1116429801 14:44832963-44832985 CTAGTTTGTCAATTCTTTTATGG + Intergenic
1117794264 14:59375848-59375870 CCAGCTTATCAATTCTTTCATGG - Intergenic
1118664754 14:68056011-68056033 CCATTTTAGCAATTATTTCAAGG - Intronic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1121629283 14:95410816-95410838 CTAGGATACCTAATATTTCAGGG + Intronic
1128294856 15:66509707-66509729 TTAGTTTGCTAATTATTTCATGG - Intronic
1132358384 15:101190590-101190612 CCAGTTTATCAATTCTTACATGG - Intronic
1138627092 16:58261080-58261102 CTAGTTTACCAATTATTTCAAGG - Intronic
1140577638 16:76190332-76190354 CAAAATTACCAAATATTTCAAGG - Intergenic
1144008722 17:11125131-11125153 CTTTTTTACTAAATATTTCATGG - Intergenic
1144226373 17:13151869-13151891 CTAGTTTATTATTTCTTTCATGG + Intergenic
1144266835 17:13577705-13577727 CAAGTTCACCAATTAATTAATGG + Intronic
1145387252 17:22423890-22423912 CCAGATTACTAATTATGTCAAGG - Intergenic
1146421926 17:32694982-32695004 ATAGTCTGCTAATTATTTCATGG + Intronic
1148112234 17:45151723-45151745 CAAGTCTACAAATAATTTCATGG - Exonic
1148329191 17:46803167-46803189 CTTCTGTACCAATTATTGCAGGG + Intronic
1149527011 17:57364498-57364520 CAAATTCAACAATTATTTCAAGG + Intronic
1150039007 17:61838044-61838066 CTAATTTACCATTTAATTTATGG + Intronic
1150253734 17:63726246-63726268 CTAGTTGACTCATTTTTTCATGG - Intronic
1154960239 18:21301165-21301187 ATAATTTGCCATTTATTTCATGG + Intronic
1155027279 18:21953004-21953026 CTATTTTTCCATTTATTTAAAGG + Intergenic
1156784716 18:40896446-40896468 CTAGTTTGCCCATTCTTTAATGG + Intergenic
1157650989 18:49330767-49330789 CCAGTTTCCTCATTATTTCAGGG - Intronic
1160251756 18:77209607-77209629 CTAATTTTCCATTTATTCCACGG + Intergenic
1163174368 19:15553824-15553846 TTAATTTACCAAATATTTCTTGG + Intergenic
1166467955 19:43050830-43050852 CCACTTTATCATTTATTTCAAGG + Intronic
1167904129 19:52644283-52644305 CTATTTTGCCAATCATTTCAGGG + Intronic
1167906180 19:52662648-52662670 CTATTTGGCCAATCATTTCAGGG + Intronic
1167908885 19:52685166-52685188 CTATTTTGCCAATCATTTCAGGG + Intronic
1167918614 19:52762519-52762541 CCATTTTGCCAATCATTTCAGGG + Intergenic
1167927868 19:52836288-52836310 CTATTTGACAAAGTATTTCAGGG + Intronic
1167929922 19:52855790-52855812 CTATTTTGCCAATCATTTCAGGG + Intronic
1167944850 19:52979839-52979861 CTATTTTGCCAATCATTTCAGGG + Intergenic
1168000940 19:53445573-53445595 CTATTTTGCCGATCATTTCAGGG - Intronic
1168005305 19:53482080-53482102 CTATTTTGCCAATCATTTCAGGG - Intronic
925471525 2:4166796-4166818 CCAGCTTATCAATTTTTTCATGG + Intergenic
926771532 2:16381248-16381270 TTACTTTTCTAATTATTTCAAGG + Intergenic
927004036 2:18828864-18828886 CTATTTTTCCAATAATTTTATGG + Intergenic
928564121 2:32525882-32525904 CTATTTCATCAATCATTTCATGG - Intronic
928942497 2:36740815-36740837 CTTTTAAACCAATTATTTCATGG + Intronic
930610926 2:53542522-53542544 CTAGTTTACCATTTTTTCTAAGG + Intronic
931105943 2:59055881-59055903 TTGGGTTAGCAATTATTTCAAGG - Intergenic
932158876 2:69442943-69442965 CTAGTTTCCCATTTTTATCAAGG - Intergenic
933115377 2:78462933-78462955 TTGGTCTACCAATGATTTCATGG - Intergenic
933523113 2:83399987-83400009 CTAGATCATCAATTATTTCAAGG - Intergenic
934030295 2:88039014-88039036 CAGGTTTACTAATTATTTCAAGG - Intronic
935286548 2:101568797-101568819 CTAGTATATCATTTATTTCTTGG - Intergenic
935464013 2:103373589-103373611 CTAGTTTAACAATAATTTCTGGG + Intergenic
941596016 2:167478292-167478314 CTATTTTAACAATTATTAAATGG + Intergenic
941727335 2:168876503-168876525 CTAGATAACCAATTGCTTCATGG + Intronic
941972722 2:171369695-171369717 CTGTTTTAGGAATTATTTCAAGG - Intronic
942269790 2:174262811-174262833 ATAGTTCACCATTGATTTCACGG - Intergenic
943045444 2:182855402-182855424 CTATCTTTCCATTTATTTCAAGG - Intronic
945834563 2:214823186-214823208 TTACTTTCCCAATTATTTCCAGG - Intergenic
947095797 2:226565097-226565119 CTATTTTACCACTTTTCTCAAGG + Intergenic
1174918817 20:54680734-54680756 CTATTTTACCTATTATTTAATGG - Intergenic
1175164462 20:57033447-57033469 CTCGTGTCCCATTTATTTCAAGG - Intergenic
1176905559 21:14496193-14496215 CTACTTCACCAATTTTCTCAAGG - Intronic
1178040872 21:28639794-28639816 CTGGTTTACACATTATTTCTTGG + Intergenic
1180227736 21:46406038-46406060 TTAGGTTTCCAGTTATTTCAAGG + Intronic
1183810790 22:40255463-40255485 GTAGTTTATAAATTATTTAATGG - Intronic
949398294 3:3638347-3638369 CTAGCTTCCCAATCAGTTCAAGG - Intergenic
950938227 3:16865481-16865503 CTAGTTAACCACTTATTACTGGG + Intronic
951624820 3:24647514-24647536 ATAGTTCACCAATAATTTCTAGG + Intergenic
951945349 3:28129687-28129709 TTTCTTTCCCAATTATTTCAAGG - Intergenic
953428306 3:42814738-42814760 TTAGATTATAAATTATTTCATGG - Intronic
955429982 3:58832742-58832764 CTAGTATAAATATTATTTCATGG + Intronic
956331017 3:68108590-68108612 CTAGTTTGGCAATGATTTCCAGG - Intronic
956384244 3:68700330-68700352 CTAGTTTTATAATTAATTCACGG - Intergenic
956392602 3:68789288-68789310 CTAGTTGACCATATATTCCAGGG + Intronic
956527575 3:70181878-70181900 CTAAATCGCCAATTATTTCAAGG - Intergenic
958057730 3:88434692-88434714 CTACTTTAACAGTTATTTCAAGG + Intergenic
959327237 3:104952766-104952788 CTAGTGAATCATTTATTTCATGG + Intergenic
961074102 3:123965584-123965606 CTAGTTAACCAACTACTTCCAGG - Intergenic
961309522 3:125986548-125986570 CTAGTTAACCAACTACTTCCAGG + Intergenic
961985586 3:131129466-131129488 CTAGCTTCTCAATTCTTTCATGG + Intronic
962160237 3:132991434-132991456 TTAGTTTACCTATTGTTACATGG - Intergenic
963451884 3:145492128-145492150 CTAGTTTCTCCATTATGTCATGG - Intergenic
963650382 3:147971863-147971885 AGAGTTTATCAATAATTTCAAGG - Intergenic
964758257 3:160108570-160108592 ATTGTTTACCATTTACTTCATGG - Intergenic
965493597 3:169370056-169370078 CTGGTTTGGCATTTATTTCAGGG - Intronic
965645388 3:170875186-170875208 CCAGTTTACCTTTTAATTCAGGG + Intergenic
966623277 3:181988861-181988883 TTTTTTTACCATTTATTTCAGGG - Intergenic
970090343 4:12400170-12400192 CAATTTTACCAATTATGGCAGGG + Intergenic
970997232 4:22281312-22281334 GAAGATTACTAATTATTTCAGGG - Intergenic
971692906 4:29860505-29860527 TTACTTTACCAATAATTTCAAGG - Intergenic
971699920 4:29958755-29958777 CAAGCTTCCCAATCATTTCAGGG + Intergenic
973168449 4:47108314-47108336 CTCCTTTCCCATTTATTTCATGG - Intronic
973265376 4:48204972-48204994 CTAGTTCACCAACTGTGTCAGGG - Intronic
975755334 4:77566300-77566322 CTTGTTTACCAGTTCATTCAGGG + Intronic
978665738 4:111178893-111178915 CTAGTTAATTATTTATTTCATGG + Intergenic
978980001 4:114932607-114932629 TTAGTTTAACAGTTTTTTCAAGG - Intronic
979339619 4:119506295-119506317 TCAGTTTATCATTTATTTCATGG + Intronic
981397227 4:144266710-144266732 CAATTTTACCTATTATTTCCAGG - Intergenic
983676679 4:170302755-170302777 TTACTTTGCCATTTATTTCAAGG + Intergenic
983919440 4:173330138-173330160 CCAATTTATCAATTCTTTCATGG + Intergenic
986398116 5:7350808-7350830 CTCATTTACCATTTTTTTCATGG + Intergenic
986551587 5:8962077-8962099 CGAGTTTTCCTATTGTTTCAAGG - Intergenic
986917661 5:12642357-12642379 CTTGTATACAAATTATTTCCTGG + Intergenic
987581766 5:19803792-19803814 CTAGTTTATCAATCATTTCTAGG - Intronic
989506659 5:42233493-42233515 TCAGCTTACCAATTCTTTCATGG + Intergenic
989529019 5:42485090-42485112 CAAGTTTACCCATTATTTTCAGG + Intronic
989990479 5:50758250-50758272 TTAGTTTTCCAATATTTTCATGG - Intronic
990066568 5:51722992-51723014 TCGGTTTATCAATTATTTCATGG + Intergenic
992230146 5:74656017-74656039 CTAGTTCATCAATCATTTCATGG + Intronic
992473920 5:77083999-77084021 TTAGTTTAAAAATTTTTTCAAGG - Intronic
992551076 5:77860789-77860811 CTTGTTTGGCAAATATTTCACGG - Intronic
992845055 5:80738463-80738485 CTGTTCTACCAATTATCTCAGGG - Intronic
993204048 5:84856696-84856718 CTGGTTTAGCAATGATTTCTTGG - Intergenic
993251012 5:85522666-85522688 CTAGTTTACCTATGACTGCAGGG - Intergenic
993603241 5:89954850-89954872 TTAGGTTTCCAATTAATTCAAGG + Intergenic
994360887 5:98846836-98846858 CCAGTTTATTATTTATTTCATGG - Intergenic
994489286 5:100420782-100420804 GTATTTTACCAATAATTTCTAGG - Intergenic
995377947 5:111498969-111498991 CTTGTTTAGCATGTATTTCAGGG + Exonic
995615165 5:113954058-113954080 CCAATTTACCATTTATTTTATGG - Intergenic
995973391 5:118001205-118001227 CTAGTATATTATTTATTTCAAGG - Intergenic
996188336 5:120507729-120507751 CTAGTTAACCATTTTTTTTAAGG + Intronic
996353208 5:122568618-122568640 CCAGTATTCCAAGTATTTCAAGG - Intergenic
997905558 5:137813079-137813101 ATAGTTTACTAATTCTTTTAGGG - Intergenic
1000140230 5:158396227-158396249 CTTCTTTACTAATTCTTTCATGG - Intergenic
1000375267 5:160575029-160575051 CTATTATATCAATTTTTTCATGG - Intronic
1002433054 5:179214807-179214829 TTATTTTAACAATTATTTGATGG - Intronic
1004743756 6:18489922-18489944 TTATTTTACCATTTATTTTAAGG + Intergenic
1005197381 6:23303643-23303665 ATAATTTATCAATTATTTTATGG + Intergenic
1005378055 6:25205056-25205078 CTAATTTATCAATTTTTTGATGG - Intergenic
1005981632 6:30841263-30841285 CTACTTTATCAATTATGCCAGGG - Intergenic
1008693223 6:54004360-54004382 CTAGTGTTCCAATTAATTTATGG + Intronic
1010923130 6:81709312-81709334 TTAATTTACCAATTATTTTCTGG + Intronic
1011357044 6:86481946-86481968 CTAGTTTAAGAGTTATTTAAAGG + Intergenic
1013500401 6:110743823-110743845 CTATTTACCCAATTAATTCATGG + Intronic
1013760976 6:113517298-113517320 CTAGTTTCTCTTTTATTTCATGG - Intergenic
1015073142 6:129122290-129122312 CTTGTATACCAAATGTTTCATGG + Intronic
1017217660 6:151928780-151928802 ATAGTTTACCATTTATTTTGAGG + Intronic
1018475260 6:164134170-164134192 CAAGTTTATCTATTAATTCATGG - Intergenic
1018693892 6:166374438-166374460 CCAGCTTATCAATTATTTCTGGG + Intronic
1021787670 7:24168409-24168431 TTAATTTAGCAATTAATTCAAGG - Intergenic
1023953034 7:44862705-44862727 CTATTTTACCACTTATTGTATGG - Intergenic
1024157154 7:46637731-46637753 CAATTTTACCATTTGTTTCATGG - Intergenic
1026966158 7:74441465-74441487 CTAATTTACAAATTTTTTTAGGG - Intergenic
1027645509 7:80792582-80792604 CCAGGTTAACAATTATGTCAAGG + Intronic
1028194349 7:87888471-87888493 GTTGTTTAACAAGTATTTCAAGG - Intronic
1028237223 7:88376878-88376900 CTAGTTTAATAACTATGTCATGG + Intergenic
1030224641 7:107136301-107136323 CCAGCTTATCAATTCTTTCATGG - Intronic
1031307742 7:120154073-120154095 CAAGTATACCTATTATATCAAGG + Intergenic
1031490199 7:122377909-122377931 GTAGTTTTCAAATTATCTCATGG - Intronic
1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG + Intergenic
1032137920 7:129298347-129298369 CTAGTTAACTAAATATTTCAAGG + Intronic
1032885464 7:136133538-136133560 CTAACTTACCATTTAATTCACGG + Intergenic
1037211985 8:16399992-16400014 CTATTGGACCAAGTATTTCATGG - Intronic
1038110042 8:24486317-24486339 CAAGTTAACCAATTCTTGCATGG + Intronic
1039745189 8:40419297-40419319 CTTCTTTAGCAATTGTTTCAAGG - Intergenic
1041172103 8:55154198-55154220 CTAATTCAATAATTATTTCAGGG + Intronic
1042411111 8:68466675-68466697 TTATTTTAGCAAATATTTCATGG - Intronic
1046549279 8:115692891-115692913 CCAGTTTACAAAGTATTTTAAGG - Intronic
1046710325 8:117504187-117504209 TTTCTTTACCAATTATCTCAAGG + Intergenic
1047689440 8:127336245-127336267 CTAGCTTACCAATTCTTTCTGGG - Intergenic
1047792191 8:128215186-128215208 CTCGTTTAGCCATTAGTTCATGG + Intergenic
1048869389 8:138784674-138784696 ATAGTTTATCTATTATTACAAGG + Intronic
1050059921 9:1697086-1697108 TTAGTTAACCAAATATTTGAGGG - Intergenic
1050797699 9:9565002-9565024 CTAGTTTCAAAATTATCTCAAGG + Intronic
1051961996 9:22777586-22777608 CAAGTTTATCAATTCTTTCATGG - Intergenic
1052526227 9:29623065-29623087 CTTCGTTACCCATTATTTCAAGG - Intergenic
1052809977 9:33049572-33049594 CTAGCTTATCAGTTATTTCATGG - Intronic
1054944532 9:70782072-70782094 TTAGTTTGCAAATTATTTTATGG - Intronic
1057003805 9:91537836-91537858 CTAACTTACCAATTATATCCAGG + Intergenic
1186712008 X:12208039-12208061 TTAGTTTTGCCATTATTTCAAGG - Intronic
1187357644 X:18592212-18592234 ATTGTTTTCTAATTATTTCATGG - Intronic
1188920305 X:35967533-35967555 CTAGTGTATTAATTAATTCATGG + Intronic
1189352440 X:40286149-40286171 CTTGGTTACCTATTATTGCATGG - Intergenic
1189747316 X:44182656-44182678 CTTCTTGACCAATCATTTCAGGG + Intronic
1190016026 X:46828077-46828099 ATAGTTTAAAAATAATTTCAAGG - Intergenic
1193355441 X:80514910-80514932 CTTATTTACCATTAATTTCAGGG + Intergenic
1194474556 X:94342812-94342834 CTAGATTACAAGTTATTTGAGGG + Intergenic
1195028630 X:100904477-100904499 CCAGCTTATCAATTATTCCATGG - Intergenic
1197071375 X:122302158-122302180 TCAATTTATCAATTATTTCATGG + Intergenic
1198952207 X:142083902-142083924 TTACTTTACCAATAATTTTAAGG - Intergenic
1200427336 Y:3035652-3035674 CTAGCTTACCAAATATTTGCTGG - Intergenic
1202252597 Y:22888702-22888724 CTACCTTACCAATGTTTTCAGGG - Intergenic
1202405586 Y:24522451-24522473 CTACCTTACCAATGTTTTCAGGG - Intergenic
1202465194 Y:25147631-25147653 CTACCTTACCAATGTTTTCAGGG + Intergenic