ID: 1138628973

View in Genome Browser
Species Human (GRCh38)
Location 16:58278444-58278466
Sequence TGGGGTTCCCTGGGTGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138628967_1138628973 4 Left 1138628967 16:58278417-58278439 CCAGTGAGTTCTCAAAGCAAGAG 0: 1
1: 0
2: 2
3: 8
4: 194
Right 1138628973 16:58278444-58278466 TGGGGTTCCCTGGGTGTAACTGG 0: 1
1: 0
2: 1
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138628973 Original CRISPR TGGGGTTCCCTGGGTGTAAC TGG Intronic
901823392 1:11844817-11844839 TTGGGATCCATGGGGGTAACAGG + Intergenic
902163955 1:14554331-14554353 TGGGGATGCCTGGGTGATACAGG - Intergenic
904522722 1:31108211-31108233 TGCGTTTCTCTGGGTGGAACAGG + Intergenic
905970853 1:42141305-42141327 TGTGCTTCCCTGGGTGGAGCAGG - Intergenic
906649068 1:47497959-47497981 TGTGCTTCCCTGGGTGGAGCAGG + Intergenic
911132700 1:94406461-94406483 TGTGCTTCTCTGGGTGGAACAGG + Intergenic
914337757 1:146731110-146731132 TGGAGAACCATGGGTGTAACAGG - Intergenic
914801583 1:150966366-150966388 TGTGGAGCCCTGGGTATAACAGG - Intronic
916533043 1:165676696-165676718 TGGGATTCCCTGGGTGGAGTAGG - Intronic
917798032 1:178545952-178545974 TGGGATGCCCTGGTGGTAACAGG - Intronic
920065874 1:203269330-203269352 TGGGTTTCCTTGGGTATCACTGG - Intronic
922209361 1:223475910-223475932 TGGGGGCTCCTGGGTGTAACGGG - Intergenic
923142874 1:231175987-231176009 TGGGGTTTGCTGGGTGTCATGGG + Intronic
1067030409 10:42875737-42875759 TGGGGTTCTCTGGGTGTGGCAGG + Intergenic
1067153300 10:43753671-43753693 TGGACTTCCCTGGGTGTCCCAGG + Intergenic
1071217389 10:83424267-83424289 TGAGCTTCCCTGGGTGAAAAGGG + Intergenic
1071298485 10:84239692-84239714 TGGGGTTGCCTGGGAGGAGCTGG - Intronic
1071790809 10:88952194-88952216 TGGGTTTCCCTGGCTCTAACTGG - Intronic
1072222370 10:93337501-93337523 TGGGTTTCCCTGAGTCAAACTGG + Intronic
1074042687 10:109808044-109808066 TGTGCTTCCCTGGGTGGAGCAGG - Intergenic
1074389559 10:113045487-113045509 TGGGGTTCCCTGGGGGTCCCAGG - Intronic
1075114941 10:119618327-119618349 GGGAGTGCCCTGGGAGTAACTGG - Intergenic
1078433987 11:11309534-11309556 TGGGGTTTACAGGGTGTAAAAGG - Intronic
1079229191 11:18634695-18634717 CTGGGTTCTCTGGGTGTCACGGG + Intronic
1080352710 11:31403765-31403787 TTAGTTTCCCTGGGTGTTACAGG + Intronic
1084172098 11:67405710-67405732 TGGGGGTCCCTGGGCATCACCGG - Intronic
1084472447 11:69371030-69371052 TGGGTTTCCTTGCTTGTAACCGG + Intergenic
1085602605 11:77868780-77868802 TGTGCTTCTCTGGGTGTAGCAGG + Intronic
1086417875 11:86607251-86607273 TGGGATATCCTGGCTGTAACTGG + Intronic
1094844817 12:34356815-34356837 TGGGTGTCCCTGGGTGTCCCTGG - Intergenic
1103014794 12:117485529-117485551 GGGGCTTCCCTGGGGGAAACTGG + Intronic
1104389914 12:128383496-128383518 TGGGAATCCCTGGGTGTCCCGGG + Intronic
1104681922 12:130758003-130758025 TGGGGACCCCTGGCTGAAACAGG - Intergenic
1107771186 13:43788325-43788347 TGGGATGCCCTGGGTGTGAGGGG + Intergenic
1108694256 13:52888810-52888832 TGGCATTCTCTGGGCGTAACTGG + Intergenic
1111956136 13:94760614-94760636 TGTGCTTCTCTGGGTGGAACAGG + Intergenic
1112522719 13:100111604-100111626 TGTAGTTCCCTGGTTGTAAACGG + Intronic
1113112072 13:106834087-106834109 GGGGGTTAACTGGGTGTTACTGG + Intergenic
1113763968 13:112869390-112869412 TGGGGCTCCCTGGGTTTAGGGGG - Intronic
1113920807 13:113908303-113908325 TCGGGCTCCCTGGGTGTCAGCGG + Intergenic
1124007215 15:25803801-25803823 TCGGCTTCTCTGAGTGTAACCGG + Intronic
1124130729 15:26983320-26983342 GGGGGCTCCCAGGGTGTACCAGG - Intronic
1124215955 15:27807200-27807222 TGGAGTTTCCTTGGTGTTACAGG - Intronic
1131116234 15:89797767-89797789 TGGGGTTCCCAGGCTGTGGCTGG - Intronic
1131250136 15:90825054-90825076 TGGGGTGCCCGGGGTGTCCCTGG - Intergenic
1131905325 15:97135928-97135950 TGGGGAACCCTGGGAGTTACAGG + Intergenic
1132301884 15:100781200-100781222 TGGGGTTTCCTGGGGGCACCTGG - Intergenic
1132644481 16:992468-992490 TGGGGGTCCCTGGGTAGAAGGGG + Intergenic
1133031892 16:3014980-3015002 TGGGCTTCCCTAGATGTCACTGG - Exonic
1135207737 16:20496743-20496765 TGGGGTTCTGTGAGGGTAACAGG - Intergenic
1135211162 16:20526957-20526979 TGGGGTTCTGTGAGGGTAACAGG + Intergenic
1138628973 16:58278444-58278466 TGGGGTTCCCTGGGTGTAACTGG + Intronic
1139996523 16:70986223-70986245 TGGAGAACCATGGGTGTAACAGG + Intronic
1140788555 16:78367490-78367512 TTGGCTTCCCTGGGTGACACTGG - Intronic
1142979896 17:3665613-3665635 TGTGCTTCCCTGGGTGGAGCAGG - Intronic
1145211047 17:21013295-21013317 GGGGCTTCCCCGGGTGTACCTGG - Intronic
1149015449 17:51903905-51903927 CTGGGTTCCCTGGATGTACCAGG + Intronic
1149601396 17:57895409-57895431 TGGGGGTGCCTGGGTGCCACTGG + Intronic
1152362093 17:79837498-79837520 TGGGGCTCCCAGGTTGCAACAGG + Intronic
1154339693 18:13492730-13492752 TGGGGTGCCCTGGGAGCACCAGG + Intronic
1156543176 18:37937287-37937309 TGGGGCTCCCTGGGTGTCTGCGG + Intergenic
1160371775 18:78378066-78378088 TGGGGCTGCCTGGGTCTAACAGG - Intergenic
1162775102 19:12974789-12974811 TGGGGTTCCCTGGGAGTGGGTGG + Intergenic
1167024653 19:46906396-46906418 TGGGGAGCCCTGGATGGAACTGG - Intergenic
1168277965 19:55287457-55287479 TGGGGTTCCCTGTGTGTCAGGGG - Intronic
927149920 2:20189633-20189655 TGTGGGTCCCTGGGTGCACCTGG + Intergenic
927826906 2:26315618-26315640 TGGGGCTCCCTGGGTGCCTCAGG + Exonic
927924073 2:26997433-26997455 TGGGCTTCCCTGGGTCACACGGG - Intronic
928922561 2:36540709-36540731 TGGGGTAACCTTTGTGTAACAGG + Intronic
932052793 2:68416138-68416160 AGTGGTTGCCTGGGTGTTACAGG + Intergenic
932166617 2:69513664-69513686 TAGACTTCCCTGGGAGTAACAGG + Intronic
934851064 2:97701519-97701541 TGGGGATCCCTGGGTGGGCCAGG + Intergenic
935126281 2:100226136-100226158 TGGGGTCCCATGGGGTTAACTGG - Intergenic
938170509 2:129071496-129071518 TGGGGTCCTCTGGGTGTAGATGG - Intergenic
938364221 2:130721242-130721264 TGGGCTTCCTTGGCTGTGACAGG - Intergenic
941807480 2:169723648-169723670 TTGGGTTCCCTGGGTCACACTGG - Intronic
944210065 2:197197909-197197931 TGAGGTTACCAAGGTGTAACAGG + Intronic
944957386 2:204828013-204828035 TGGTGTCCCCTGGGTTGAACTGG - Intronic
949047597 2:241879225-241879247 TGGGGTTCCCTGGGAGGGTCTGG + Intergenic
1172690303 20:36785249-36785271 TGGGGTCCCCTGGGTGGACGAGG - Exonic
1176196298 20:63837565-63837587 TGGGGTTCCCTTGGTGGATATGG + Intergenic
1176944762 21:14966032-14966054 TGGGGTTCCCCAGGAGCAACTGG + Exonic
1179160704 21:38894976-38894998 TGGCCTTCCATGGGTGTCACAGG - Intergenic
1181431343 22:22883507-22883529 TGGAGGTCCCTGGGTGTAGACGG + Intronic
1183684009 22:39351110-39351132 TGGGGCTCCCTGGGTTTGGCTGG + Intronic
954149590 3:48650755-48650777 TAGGGTTCCCTGGGTGTAAGTGG + Intronic
954934175 3:54311723-54311745 TGTGGTTCCCTTGGGGTAAAAGG - Intronic
956133431 3:66075647-66075669 GGGGGTGCCCTGTCTGTAACAGG + Intergenic
957309901 3:78506227-78506249 TGGGTTTCCCTGGCAGTAGCCGG - Intergenic
958536348 3:95409206-95409228 TGGGGTTCCATGAGTAAAACAGG - Intergenic
961985220 3:131124621-131124643 TGGGGTTCTCTTGGTGTGGCAGG - Intronic
965771197 3:172182640-172182662 TGGAATTCCCTGCGTTTAACAGG - Intronic
969521238 4:7678878-7678900 TGGGCTTCCCTATGTGCAACAGG + Intronic
970203371 4:13631884-13631906 TGTGCTTCCCTGGGTGGAGCAGG + Intergenic
971243509 4:24909431-24909453 AGGGGTTCCATGGGTGTGACTGG - Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
978045370 4:104119135-104119157 TGGGGTTGTCTGGTTTTAACTGG + Intergenic
982975121 4:162047078-162047100 TGGGCTTACCTGGGGGTATCTGG - Intronic
983511659 4:168615620-168615642 TGAGGATCCCTTGGTGGAACTGG - Intronic
986082287 5:4407694-4407716 TGGGGCTCCCTGGATGTCAGGGG + Intergenic
988655936 5:33211677-33211699 GGGGTGTCCCTGTGTGTAACAGG - Intergenic
1001946013 5:175778832-175778854 TGGGCTCCTCTGGGTGTGACAGG + Intergenic
1002331969 5:178449354-178449376 TGTGGTTCCCTGATAGTAACTGG + Intronic
1002453087 5:179330763-179330785 TGGGGTGCCCAGGCTGTCACGGG - Intronic
1005013100 6:21354652-21354674 TGGGTGTCTCTGGGTATAACAGG + Intergenic
1008687421 6:53941285-53941307 TGGGGTTCCCTGGCTGGGAATGG + Intronic
1014072916 6:117204019-117204041 TGGGGTACCCTGGGAGTCATTGG - Intergenic
1017438830 6:154443333-154443355 TGGGGGTCCCTGTGTCTTACAGG + Intronic
1019421679 7:953910-953932 CGGGGGTCCCTGGGTGTGAGCGG - Intronic
1020533604 7:9365150-9365172 ATGGGTTCCCTGGTTGTAAATGG - Intergenic
1022207036 7:28174894-28174916 TCGGGAACCCTGGGAGTAACAGG + Intronic
1022210199 7:28201132-28201154 GGGGGTTTCCTGTGTGTTACAGG + Intergenic
1029202222 7:98846814-98846836 TTGGGTTCCCTGTGTGTGAGGGG - Exonic
1033673260 7:143512693-143512715 AGGGCTTCCCTGGGTGCATCAGG + Intergenic
1039585437 8:38703321-38703343 TGAGGTTCCCTGGCTGGAGCAGG + Intergenic
1042692266 8:71513891-71513913 TGCAGTTCCATGGGTGGAACTGG - Intronic
1045011707 8:97964345-97964367 TGGGGTGCCCTGTGTGTAGATGG + Intronic
1045821539 8:106344158-106344180 TGGGGTTCCCTGGTTTTAGGAGG + Intronic
1046812027 8:118543711-118543733 TTGGCTTCCCTGGGTGACACTGG - Intronic
1048587018 8:135783580-135783602 TGGGGGACCCTTGGTGTACCCGG + Intergenic
1048590907 8:135820061-135820083 TGGGATTCCATGGGAGTAATGGG - Intergenic
1049756932 8:144314934-144314956 TGGGGGTCTCTGGTTGTCACAGG + Exonic
1057322783 9:94030271-94030293 GGGGTTTGCCTGCGTGTAACAGG - Intergenic
1057818253 9:98311598-98311620 TGGGGTTACCTCTGTGCAACTGG + Intronic
1057897878 9:98924327-98924349 AGGGGTTCCCTGTGGCTAACAGG - Intergenic
1061370664 9:130195748-130195770 GGGGTTTCCCTGGGTGGAACGGG + Intronic
1062252594 9:135605730-135605752 TGGGATTCCCTGGGTGGAAGAGG + Intergenic
1192631648 X:72782080-72782102 TGAGGTTCTCTTGGTGGAACAGG + Intronic
1192634950 X:72807637-72807659 TGAGGTTCTCTTGGTGGAACAGG + Intronic
1192646765 X:72913166-72913188 TGAGGTTCTCTTGGTGGAACAGG - Intronic
1192650061 X:72938721-72938743 TGAGGTTCTCTTGGTGGAACAGG - Intronic
1200931567 Y:8701576-8701598 AGGGGCTCTCTGGGTGAAACAGG + Intergenic