ID: 1138631216

View in Genome Browser
Species Human (GRCh38)
Location 16:58295551-58295573
Sequence ACGGAGCCACAGGGGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138631205_1138631216 24 Left 1138631205 16:58295504-58295526 CCAGGACTCGAGAAGTGTCGACA 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1138631216 16:58295551-58295573 ACGGAGCCACAGGGGGAGGGTGG 0: 1
1: 0
2: 3
3: 44
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138631216 Original CRISPR ACGGAGCCACAGGGGGAGGG TGG Intronic
900254195 1:1688771-1688793 ACGGAGGCGCAGGGAGGGGGCGG + Intronic
900262911 1:1741713-1741735 ACGGAGGCGCAGGGAGGGGGTGG + Intronic
900302039 1:1982684-1982706 CCGGGCCCACAGGAGGAGGGCGG + Intronic
900380850 1:2383070-2383092 ATGGGGCCACATGGGGATGGAGG - Intronic
900414441 1:2528565-2528587 CCGGAAGAACAGGGGGAGGGAGG - Intergenic
900500418 1:3001753-3001775 ACAGAGTCACAGGGTGAGGGCGG + Intergenic
900531011 1:3153192-3153214 ACGGAGCTACAGGGGTGAGGAGG - Intronic
900867505 1:5278718-5278740 AGGAAGCCACAGGAGGTGGGAGG - Intergenic
901127685 1:6940932-6940954 GGGGATCCTCAGGGGGAGGGGGG + Intronic
901152397 1:7112621-7112643 AGGGACACACAGCGGGAGGGAGG - Intronic
901447274 1:9316207-9316229 CCGGAGCCCCAGGGTCAGGGAGG - Intronic
901659568 1:10789996-10790018 AGGAGGCCACTGGGGGAGGGGGG - Intronic
902394553 1:16125423-16125445 AGGGAGGCAGAGGAGGAGGGTGG + Intronic
902918261 1:19651642-19651664 AGGGAGGGACAGAGGGAGGGAGG - Intronic
903239472 1:21973456-21973478 ACGGAGCCCCATGGGGCAGGGGG - Intergenic
903665281 1:25003342-25003364 ACCGACCCACAGGGTGAGAGTGG + Intergenic
905597260 1:39218628-39218650 AGAGAGCCACAGTGAGAGGGAGG - Intronic
905703950 1:40040508-40040530 CGGGAGCGACACGGGGAGGGCGG - Exonic
906141607 1:43537000-43537022 AAGAAACCACAGTGGGAGGGTGG - Intronic
908762710 1:67526677-67526699 AGGGAGAGAGAGGGGGAGGGAGG + Intergenic
910920894 1:92345446-92345468 AGGGAGGGACAGAGGGAGGGAGG + Intronic
911105704 1:94129765-94129787 AGGGAGGCACGGGGGTAGGGTGG + Intergenic
913631361 1:120713154-120713176 ACGGAGCAAGACGGGGGGGGGGG + Intergenic
914195581 1:145446482-145446504 AAGGAGGCAGAGAGGGAGGGGGG + Intergenic
915445444 1:155972066-155972088 TGGATGCCACAGGGGGAGGGTGG - Intronic
915579428 1:156804643-156804665 AGGGAGGCAGAGGGGCAGGGAGG - Intergenic
916406916 1:164506918-164506940 ACTGAGACACAGGGGGAGCAGGG + Intergenic
919661724 1:200254233-200254255 CCAGAGCCACAGAGGGAAGGGGG + Intergenic
919812800 1:201419744-201419766 GCGGAGGCAGAGGTGGAGGGAGG - Intronic
921148134 1:212378498-212378520 AGGCAGCTACAGGGGCAGGGAGG - Intronic
922164831 1:223106999-223107021 ACGGAGCCACATTGGGAAGTGGG - Intergenic
922917894 1:229273100-229273122 ACGGAGCACTAGGGGAAGGGTGG + Intronic
922983736 1:229850485-229850507 ATGGGGCCAGAAGGGGAGGGAGG - Intergenic
923800210 1:237201733-237201755 AGAGAGCCACAGGAGGAGTGAGG - Intronic
924206170 1:241713350-241713372 AGGGAGGGACAGAGGGAGGGAGG + Intronic
924673636 1:246153422-246153444 AGGGAGGGAGAGGGGGAGGGAGG + Intronic
1062780363 10:199318-199340 ACGGAGGGAGAGAGGGAGGGAGG - Intronic
1062838658 10:652537-652559 ACGGAGCTGCAGTGGGAGGCGGG + Exonic
1063225772 10:4013468-4013490 AGGGAGGGAGAGGGGGAGGGAGG - Intergenic
1064121452 10:12623172-12623194 ACGGAGGGACGGAGGGAGGGAGG - Intronic
1064432482 10:15283129-15283151 AGGGAGTTACAGAGGGAGGGAGG + Intronic
1065747962 10:28859106-28859128 ATGGAGCCACAGGTGGATGAAGG - Intronic
1065976027 10:30842997-30843019 ACTGATCCATAGGGAGAGGGAGG - Intronic
1066102759 10:32132541-32132563 GCGGAGCCACAGGCAGTGGGAGG - Intergenic
1067067891 10:43113796-43113818 ACAGAGGCCCAGAGGGAGGGAGG - Intronic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1068597018 10:58913207-58913229 AGGGAGGGACAGAGGGAGGGAGG + Intergenic
1069038499 10:63670308-63670330 CAGGAGCCAAAGAGGGAGGGAGG - Intergenic
1069627958 10:69880105-69880127 AGGGAGACACAGGGAGAGAGGGG - Intronic
1070065330 10:73027879-73027901 AGGGAGGGACAGAGGGAGGGAGG + Intronic
1070555877 10:77527436-77527458 AGGCAGTCACAGGGGGAGAGGGG + Intronic
1070661787 10:78311757-78311779 AGGGAGGGACAGAGGGAGGGAGG - Intergenic
1071167829 10:82827454-82827476 ATGGAGCCAAAGGAGAAGGGTGG - Intronic
1071223418 10:83496902-83496924 TCCCAGCCACAGTGGGAGGGAGG + Intergenic
1071301446 10:84258726-84258748 ACGGGGCCACTGGGGAAGGTGGG - Exonic
1072545123 10:96431473-96431495 ACAGAGCCACAGGGAGGGGAAGG + Intronic
1074909990 10:117899718-117899740 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1075994338 10:126864917-126864939 AAGGAGCAAGAGTGGGAGGGAGG - Intergenic
1076662032 10:132062100-132062122 ACAGAGACACAGGGGAAGAGGGG + Intergenic
1077050320 11:563491-563513 CCGGTGCCCCAGGGGGAGGTGGG - Intronic
1077227454 11:1444647-1444669 GCGGAGGGAGAGGGGGAGGGAGG - Intronic
1077309187 11:1880941-1880963 AGGGAGCCACAGGCTGACGGGGG + Intronic
1077360269 11:2137692-2137714 ACAGAGCCAGAGGGGGTGTGGGG + Intronic
1077557319 11:3231876-3231898 ACAGAGCCACCGGGGGTGGGGGG + Intronic
1077922955 11:6655437-6655459 CCGGAGACAATGGGGGAGGGGGG - Intronic
1078103335 11:8343149-8343171 ACAGAGCCCCAGTGGGAGCGTGG + Intergenic
1078522888 11:12077543-12077565 ACAGAGACAAAGGAGGAGGGAGG - Intergenic
1078820455 11:14875244-14875266 ACGAAGCCACAGGTGGAGATGGG - Intergenic
1079131667 11:17750301-17750323 GCTGAGCCACAGAGGCAGGGAGG + Intronic
1081744803 11:45465323-45465345 AGGGAGTCTCAGAGGGAGGGAGG - Intergenic
1081865446 11:46357274-46357296 ATGAAGTCACAAGGGGAGGGTGG - Intronic
1081988387 11:47324243-47324265 ACTGTGGCACAGGGGGAGAGTGG - Exonic
1083709448 11:64539129-64539151 GCGGAGCCAGAGGGGGGCGGGGG + Intergenic
1083729090 11:64643346-64643368 AGGGAGCGGCCGGGGGAGGGGGG + Intronic
1083814674 11:65125921-65125943 AGGGGGCCTCAGGAGGAGGGAGG + Exonic
1084935447 11:72584333-72584355 AAGGAACCACCGGTGGAGGGAGG + Intronic
1085313352 11:75529082-75529104 ACGGAGGCAGAGGGGTAGGAAGG - Intergenic
1085476719 11:76793814-76793836 AGGGTCCCACATGGGGAGGGGGG + Intronic
1085523993 11:77153852-77153874 ACTGAGACACACGGGGAGGCTGG - Intronic
1085527669 11:77173637-77173659 AGGGAGGCACAGGGGGAAGCTGG + Intronic
1085566573 11:77520005-77520027 GTGGAGCCACGGGCGGAGGGGGG - Intronic
1085725661 11:78952473-78952495 AGGGAGAGACAGGGGCAGGGAGG + Intronic
1086338941 11:85827394-85827416 AGGGAGCCATAGGGGTAGTGAGG - Intergenic
1086826212 11:91502096-91502118 AGGGAGGCACGGAGGGAGGGAGG + Intergenic
1087643719 11:100783484-100783506 AAGAAGGCACAGTGGGAGGGTGG + Intronic
1089069596 11:115689193-115689215 AGGAAGCCACATGGGGAGGCAGG - Intergenic
1089175804 11:116547972-116547994 AGGGAGGCACAGGTGGAGGGAGG - Intergenic
1089619694 11:119715033-119715055 AGGGAGCTTCAGGGGGAAGGGGG + Intronic
1090243585 11:125200595-125200617 ACGGAGGGCCAGGGGGAGGTTGG - Intronic
1092743106 12:11649321-11649343 ACGGAGCCAGGGGAGGTGGGAGG + Intergenic
1092974340 12:13729807-13729829 AGGAAGCCATATGGGGAGGGGGG + Intronic
1093206651 12:16259405-16259427 AGGGAGGAACTGGGGGAGGGAGG - Intronic
1094301088 12:28966183-28966205 ATGAAGCCCCAGGGGCAGGGGGG + Intergenic
1097904064 12:64902244-64902266 AAGGAGGCAGAGAGGGAGGGAGG - Intergenic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098820868 12:75227231-75227253 AGGGAGGGACAGAGGGAGGGAGG + Intergenic
1099115393 12:78617776-78617798 AGGGAGCGAAGGGGGGAGGGAGG + Intergenic
1101320470 12:103668973-103668995 TCAGAGCCACAGGCAGAGGGTGG - Intronic
1101652120 12:106686862-106686884 CCTGGGCCACAAGGGGAGGGAGG - Exonic
1102171015 12:110842579-110842601 ATGGGCCCACAGGTGGAGGGAGG - Intergenic
1102186544 12:110951900-110951922 AGGGAGACAGAGGGAGAGGGAGG + Intergenic
1102233661 12:111280743-111280765 ACAGAGCCACACAGGGAAGGAGG - Intronic
1102898191 12:116615409-116615431 ACGGAGGCTCCGGGGGAGGGTGG + Intergenic
1102969572 12:117155561-117155583 GCGGAGGCCCTGGGGGAGGGCGG + Intronic
1103237691 12:119387012-119387034 AGAGAGACAGAGGGGGAGGGAGG - Intronic
1103883915 12:124186959-124186981 ACAGAGACAGAGAGGGAGGGAGG + Intronic
1103971635 12:124676213-124676235 CCGGAGCCGCAGGCGGAGCGAGG - Intergenic
1104008392 12:124911960-124911982 ACGGAGCACCAGGTGCAGGGTGG + Exonic
1104008424 12:124912188-124912210 ACGGAGCACCAGGTGCAGGGTGG + Exonic
1104008456 12:124912416-124912438 ACGGAGCACCAGGTGCAGGGTGG + Exonic
1104008615 12:124913556-124913578 ACGGAGCACCAGGTGCAGGGTGG + Exonic
1104022966 12:125006012-125006034 TCGAAGACACAGGGAGAGGGCGG - Intronic
1104153591 12:126108874-126108896 ATACAGCCACGGGGGGAGGGTGG + Intergenic
1104727746 12:131088194-131088216 ACTGAGCCCCAGAGAGAGGGGGG + Intronic
1104799511 12:131544184-131544206 GAGGAGGCACAGGGGGAGTGGGG - Intergenic
1104920794 12:132289722-132289744 ATGGAGCCCCGGGTGGAGGGAGG - Intronic
1105278458 13:18949539-18949561 ACCCAGCCACGGGGGGACGGGGG + Intergenic
1105835181 13:24204066-24204088 AGGAAGCCACAGGGGGAGTGTGG + Intronic
1107126973 13:36856542-36856564 ACCCAGCCTCAGGGTGAGGGAGG + Intronic
1107375172 13:39796611-39796633 ACGGGGGCAGAGAGGGAGGGAGG + Intergenic
1107993337 13:45837594-45837616 AGGGAGGGACAGAGGGAGGGAGG + Intronic
1108332681 13:49405760-49405782 ACGGAGGGACAGAGGGAGGGAGG + Intronic
1108723716 13:53158879-53158901 AGGGAGGGACAGAGGGAGGGAGG - Intergenic
1111396349 13:87672939-87672961 ACGGAGGAAGAAGGGGAGGGAGG - Intronic
1111664057 13:91245177-91245199 AAGCAGACACAGGGAGAGGGAGG - Intergenic
1112138131 13:96606584-96606606 AGGGAGGGACAGAGGGAGGGAGG + Intronic
1112967199 13:105211540-105211562 ACAGAGCCAGCTGGGGAGGGAGG - Intergenic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113494220 13:110714672-110714694 ACGGGGCTGCAGGAGGAGGGCGG + Intronic
1113808430 13:113123253-113123275 ACGGAGACAGAGAGAGAGGGAGG + Intronic
1113843122 13:113371502-113371524 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843139 13:113371542-113371564 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843156 13:113371582-113371604 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843173 13:113371622-113371644 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843190 13:113371662-113371684 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843267 13:113371859-113371881 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1115078520 14:29421298-29421320 AGGGAGACATGGGGGGAGGGAGG + Intergenic
1115391562 14:32860479-32860501 ACAGAGCCACAGAGGGAGCCAGG - Intergenic
1115402245 14:32975293-32975315 ACGGAGGCAGGGAGGGAGGGAGG - Intronic
1115651157 14:35403974-35403996 CCGGGGCCGCGGGGGGAGGGGGG - Intronic
1115762737 14:36591445-36591467 ACGGAGGCACAGAGGGAGGTTGG + Intergenic
1116918328 14:50547052-50547074 ACATGGACACAGGGGGAGGGGGG + Intronic
1117755667 14:58971775-58971797 ACAGAGACACGGGGGGAGAGAGG - Intergenic
1118370841 14:65136000-65136022 ATCTAGCAACAGGGGGAGGGAGG - Intergenic
1118744404 14:68763326-68763348 AGGGAGCCAGGGAGGGAGGGAGG - Intergenic
1119383264 14:74241540-74241562 ACTGAGCCACAGAGTGGGGGCGG + Intronic
1119787642 14:77325096-77325118 CCGGAAACACAGGGTGAGGGTGG + Intronic
1121430934 14:93888046-93888068 AGGGAGGGACAGAGGGAGGGAGG - Intergenic
1121688916 14:95860672-95860694 AGGGAGGAAAAGGGGGAGGGAGG + Intergenic
1121729672 14:96177674-96177696 ACTGAGGCCCAAGGGGAGGGGGG - Intergenic
1122001073 14:98653904-98653926 TCGGTTCCCCAGGGGGAGGGGGG - Intergenic
1122292755 14:100688366-100688388 GCGGAGCTTCAGGAGGAGGGAGG - Intergenic
1122544114 14:102512918-102512940 AGGAAGCCCCAGGTGGAGGGCGG + Intergenic
1122550614 14:102547203-102547225 ACGGAGGGACGGAGGGAGGGAGG + Intergenic
1122738897 14:103859520-103859542 AAGGAGCCAGGGAGGGAGGGAGG + Intergenic
1123204036 14:106694774-106694796 CTGGAGCCACCGGGGGGGGGGGG - Intergenic
1202921513 14_KI270723v1_random:33381-33403 AGGGAGGGACAGAGGGAGGGAGG + Intergenic
1124217165 15:27816953-27816975 GCGGAGACATAGGGGAAGGGAGG - Intronic
1124848238 15:33311550-33311572 AAGGAGCCAGCGGGGCAGGGGGG + Intronic
1125171420 15:36770286-36770308 AGGGAGCGAAAGAGGGAGGGAGG + Intronic
1125344020 15:38700709-38700731 ACAGAGACAGAGAGGGAGGGAGG + Intergenic
1125602542 15:40923489-40923511 AGGGAGGCTCAGGGGAAGGGAGG - Intergenic
1125730623 15:41890875-41890897 ATGGAGCCACAGGGGGCTGGGGG - Intronic
1126096757 15:45095655-45095677 ACGGAGACACAGGCAGAGGGAGG + Intronic
1127642782 15:60931226-60931248 ACGGAGGCACATTGGGAGGTAGG + Intronic
1127919472 15:63481991-63482013 ACGGAGAGGCAGGGGGATGGAGG - Intergenic
1128440906 15:67707671-67707693 TCTGAGCCACAAGGGGAAGGGGG + Intronic
1128780241 15:70354425-70354447 GCGGGGCCGCAGGGGCAGGGGGG - Intergenic
1129020495 15:72513688-72513710 AGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129020505 15:72513708-72513730 AAGGAGGGACAGGGGGAGGGAGG - Intronic
1129020524 15:72513746-72513768 AGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129020534 15:72513766-72513788 AGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129020542 15:72513782-72513804 AAGGAGGGAGAGGGGGAGGGAGG - Intronic
1129665260 15:77576071-77576093 ACTGAGGCACAGGGAGAGGAGGG - Intergenic
1129679128 15:77648048-77648070 CAGCAGCCACAGGGAGAGGGTGG + Intronic
1129688825 15:77701697-77701719 AGGGAGCCATGGGTGGAGGGAGG - Intronic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1132563854 16:611502-611524 ACAGAACCACCGGAGGAGGGAGG + Intronic
1132611228 16:817244-817266 ACGGAGCGAGAAGGGGAGGGTGG + Intergenic
1132656158 16:1042839-1042861 ACGGTGCCACAGTGGGAGGAAGG + Intergenic
1132751851 16:1461285-1461307 GCGGAGTCAGAGGAGGAGGGAGG + Intronic
1132830520 16:1925797-1925819 ACGTGGGCACAGGTGGAGGGGGG + Intergenic
1133044822 16:3081928-3081950 ACGGAGCCACACGGGGGGCAAGG + Intronic
1133267546 16:4594054-4594076 AAGGAGCCAGGGAGGGAGGGTGG - Intronic
1133407707 16:5538870-5538892 ACGGAGCCACTGGCTGAGGTGGG - Intergenic
1134467978 16:14495811-14495833 ACAGAGGCACAGAAGGAGGGAGG + Intronic
1135530280 16:23247122-23247144 ACGGAGCAAGAGAGTGAGGGAGG - Intergenic
1135573275 16:23565850-23565872 ACGGGGGCGCAGGGGGAGGGGGG - Intronic
1136234527 16:28905616-28905638 AGGGAGACACAGAGGGCGGGAGG + Intronic
1136475426 16:30510263-30510285 ACAGAGCCCCTGGGGGAGGTAGG + Intronic
1136589061 16:31206309-31206331 AGGGAGGGAGAGGGGGAGGGAGG - Intergenic
1136686181 16:31996161-31996183 AAGGTGCTACAGGTGGAGGGCGG + Intergenic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1137620934 16:49876413-49876435 CCAGAGCCACGGGGGGTGGGAGG + Intergenic
1137830597 16:51539687-51539709 ATGGAGACAGAAGGGGAGGGAGG - Intergenic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138317985 16:56086806-56086828 ACAGGGCCACAGGGGCAGGTGGG + Intergenic
1138631216 16:58295551-58295573 ACGGAGCCACAGGGGGAGGGTGG + Intronic
1139216003 16:65124028-65124050 AGGGACCCACAGGGGGAGGCAGG - Intronic
1140412413 16:74748943-74748965 ATGGAGGCCCAGGGGGAAGGTGG + Intronic
1140809988 16:78567722-78567744 ACTCAGCCACAGAGGCAGGGTGG - Intronic
1140828066 16:78726100-78726122 AGGGAGGCAGAGAGGGAGGGAGG - Intronic
1140834178 16:78778234-78778256 AAGGAGACACAGGGGATGGGAGG - Intronic
1140914615 16:79482953-79482975 AAGGAGGGACAGAGGGAGGGAGG - Intergenic
1141162189 16:81636847-81636869 ACGGGGCTTCAGGGGGTGGGGGG - Intronic
1141426275 16:83946605-83946627 GAGGAGCCATAGGAGGAGGGTGG - Intronic
1141526093 16:84612898-84612920 ACTGAGGCACAGAGGGAGGGAGG + Intronic
1142599717 17:1047742-1047764 ATGGAGGCAGTGGGGGAGGGAGG - Intronic
1142631715 17:1229849-1229871 GCGGAGCCGCCGGGGGAGGGCGG + Intergenic
1142752709 17:1998237-1998259 CCGGAGCTGCAGGGCGAGGGCGG + Intronic
1144797056 17:17899082-17899104 AGGGAACCAAAGGCGGAGGGAGG + Intronic
1145991378 17:29081108-29081130 ATAAAGACACAGGGGGAGGGAGG + Intronic
1146505267 17:33399430-33399452 AGGGAGACAGAGGGGGAAGGGGG - Intronic
1146959848 17:36964756-36964778 ACTGAGCTACAGTGGGGGGGAGG - Intronic
1147161379 17:38571362-38571384 ACCGAGCCATGGGTGGAGGGTGG + Intronic
1147200686 17:38799562-38799584 ACGGAACCACCGGGGCGGGGTGG - Exonic
1147388860 17:40097256-40097278 AGGGAGCCAGTGGGGGATGGTGG + Exonic
1147420369 17:40319410-40319432 ACAGAGCCAGAGGGGGCAGGAGG - Intronic
1147495028 17:40907408-40907430 AGGGAGACAGAGAGGGAGGGGGG - Intergenic
1147575116 17:41594545-41594567 AAGGAAGCACAGAGGGAGGGAGG + Intergenic
1147916205 17:43888422-43888444 ATGGAGCCCCAGAGTGAGGGAGG + Intronic
1148262003 17:46192747-46192769 TGGGAGCCACAGGGAGAGCGAGG + Exonic
1148699584 17:49579569-49579591 ACGGAGCCACAGAGAGATGCTGG + Exonic
1148722465 17:49763840-49763862 AAGGAGCCATTGGGGGAGGGGGG - Intronic
1148755467 17:49970800-49970822 TCAGAGCCACAGGAGAAGGGAGG - Intronic
1148787015 17:50150482-50150504 ACGGAGCCACGGGGGCCCGGGGG - Exonic
1151199381 17:72456456-72456478 ACAGAGCCAGAGGGGCAGGGAGG + Intergenic
1151801867 17:76383816-76383838 GCTGAGCCAGAGGGGGCGGGGGG + Intronic
1152037697 17:77883498-77883520 AAAGAGCCACAGCGGGACGGAGG - Intergenic
1152352902 17:79793227-79793249 ACTCCGCCAAAGGGGGAGGGAGG - Exonic
1152375262 17:79915619-79915641 ATGAAGCCACAGGTGGAAGGTGG + Intergenic
1152559716 17:81071979-81072001 CCGGAAGCAGAGGGGGAGGGGGG - Intronic
1152587234 17:81194508-81194530 AGTGAGCCACAGGAGGAGGCAGG - Intronic
1152631501 17:81412687-81412709 ACAGAGCCACAGGGTGGGGCGGG - Intronic
1152677925 17:81651201-81651223 ACAGGGCCACAGGGGATGGGGGG - Intronic
1152823837 17:82450920-82450942 GCGGAGCCGCAGGAGGAGGCGGG + Intergenic
1152895546 17:82909048-82909070 ACTGAGGCACAGAGAGAGGGAGG - Intronic
1153457949 18:5299002-5299024 TCAGAGTCACAGGGGGAAGGTGG - Intergenic
1153515345 18:5895972-5895994 ACCGAGGCACGAGGGGAGGGAGG - Intergenic
1154268919 18:12902359-12902381 AGTGAACCACAAGGGGAGGGTGG + Intronic
1155054072 18:22170091-22170113 TCGGAGCGAGTGGGGGAGGGAGG - Intronic
1155078653 18:22385844-22385866 ACGTTGACACTGGGGGAGGGTGG - Intergenic
1155528861 18:26745363-26745385 AGGGAGACACAGTGGGATGGGGG + Intergenic
1155630548 18:27887556-27887578 AGGGAGGGACAGAGGGAGGGAGG - Intergenic
1155651900 18:28152921-28152943 AGGGACTCACTGGGGGAGGGAGG + Intronic
1156369995 18:36464728-36464750 GAGGAGGCAAAGGGGGAGGGAGG + Intronic
1156475561 18:37403415-37403437 AGAGAGCCACAGGGGAGGGGTGG - Intronic
1156721122 18:40071122-40071144 AGGAAGGCAAAGGGGGAGGGAGG - Intergenic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1157562686 18:48659816-48659838 GCTGAGCCACAGGGCGGGGGTGG + Intronic
1157618813 18:49003464-49003486 AGGGAGCCAAAGGGGCAGGGTGG - Intergenic
1157819060 18:50752086-50752108 AGGGAGACAATGGGGGAGGGAGG + Intergenic
1158412517 18:57220796-57220818 ACTGAGCTCCAGGAGGAGGGAGG - Intergenic
1159889894 18:73943469-73943491 CCGGAGCCAGAGGGGAAGGCAGG + Intergenic
1160159737 18:76461951-76461973 ACAGAGTCACAGGAGGAGGGCGG - Intronic
1160432318 18:78820115-78820137 ATGGAGAAACAGGGGGAGAGAGG + Intergenic
1160934008 19:1584725-1584747 GCGGAGCCTCAGGGGGTGCGGGG + Intronic
1160952480 19:1674369-1674391 ACAGAGGGACAGAGGGAGGGAGG - Intergenic
1161010787 19:1958585-1958607 ACGGGGGGACAGGGGGACGGGGG - Intronic
1161973244 19:7595711-7595733 ACGGAGCAGCAGGGGCGGGGCGG - Intergenic
1162473166 19:10884552-10884574 AGGCAAGCACAGGGGGAGGGGGG - Intronic
1162930736 19:13956293-13956315 CCGGAGCAAGGGGGGGAGGGGGG - Intronic
1163313568 19:16528094-16528116 AAGGAGCCACGGGGTGAGGCTGG + Exonic
1163383628 19:16985624-16985646 AGGGAGGCGCAGAGGGAGGGTGG + Intronic
1163520569 19:17789191-17789213 TGGGAGCCCCAGGAGGAGGGTGG + Intergenic
1163549367 19:17957100-17957122 AGGGAGGGACAGAGGGAGGGAGG + Intronic
1163609676 19:18294410-18294432 AGGGAGCCACAGAGGGTGTGGGG - Intergenic
1163633946 19:18429887-18429909 GCAGCCCCACAGGGGGAGGGAGG + Intronic
1163640841 19:18461147-18461169 CCGGAGGCGCAGGTGGAGGGCGG + Intronic
1164559205 19:29277076-29277098 AGGGGGCCACAGGGGGAAGAGGG + Intergenic
1164581656 19:29438780-29438802 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1164788026 19:30952243-30952265 AAGGAGCAAAAGAGGGAGGGAGG - Intergenic
1165312996 19:35039912-35039934 ACGGAGCCACTGGGGTGGGAGGG + Intronic
1165776035 19:38404932-38404954 GCGGAGGCACAGGAGGCGGGTGG - Exonic
1165831475 19:38732741-38732763 ATGGAGCCACAGGGAGATGGGGG - Intronic
1165871276 19:38975404-38975426 AAGGAGCCTCAGGCCGAGGGAGG + Intronic
1165991545 19:39818097-39818119 GGGGAGCCACAGGGGGACTGTGG - Intergenic
1166302569 19:41920898-41920920 AGGGAGAGACAGAGGGAGGGGGG - Intronic
1166743797 19:45130326-45130348 CCGGAGCCACTGGGGGCGAGGGG - Intronic
1166979729 19:46625353-46625375 AGGGAGACACTGGGGGAGGGAGG - Intergenic
1167368745 19:49068295-49068317 AAAGAGCCAGTGGGGGAGGGAGG - Exonic
1167475941 19:49701044-49701066 ACGGAGACACAGAGAGAGAGGGG - Intronic
1167517653 19:49932659-49932681 GGGGAGGGACAGGGGGAGGGAGG - Exonic
1167665470 19:50820923-50820945 AGGGAGGCCCTGGGGGAGGGTGG + Intronic
1167854311 19:52225825-52225847 ACGGAGCCCTAGCAGGAGGGTGG + Intronic
1168405330 19:56107640-56107662 AAGGAAGCACACGGGGAGGGGGG + Intronic
924985011 2:263445-263467 GCGGGGCCACAGGGCGAGCGCGG - Intronic
925062574 2:904815-904837 AGGGAGCCACGTGTGGAGGGTGG + Intergenic
927093176 2:19727940-19727962 AGGGAGCCCCTGGGGAAGGGTGG - Intergenic
927193835 2:20534461-20534483 AGTGAGCCCCAGGGGGATGGAGG + Intergenic
927247854 2:20972209-20972231 ACAAAGCCAGAGGGGGAAGGTGG + Intergenic
927702493 2:25277041-25277063 CGGGAGCACCAGGGGGAGGGAGG + Intronic
929776566 2:44934216-44934238 ACAGAGCGAGAGGGGGAGAGAGG + Intergenic
929793869 2:45043520-45043542 ACGGAGGGACAGAGGGAGGGAGG - Intergenic
930159837 2:48143724-48143746 ACAAAACCACCGGGGGAGGGTGG + Intergenic
930884880 2:56314145-56314167 ACTTAGCCATAGTGGGAGGGTGG + Intronic
934713100 2:96528183-96528205 ACTGAGTCACAAGGGGAGGAGGG + Intergenic
935189135 2:100761907-100761929 AGGCAGGCTCAGGGGGAGGGTGG - Intergenic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
937025980 2:118697363-118697385 AGTGAGGCACAGGGGGAGGAAGG + Intergenic
937372435 2:121309333-121309355 AGGGAGGCAAAGAGGGAGGGAGG + Intergenic
938251489 2:129819225-129819247 AGTGAGCCACAGGATGAGGGAGG + Intergenic
941819297 2:169828169-169828191 GTGCAGCCACAGGGGGATGGAGG + Intronic
942199950 2:173560451-173560473 ACAGAGCACCTGGGGGAGGGGGG + Intergenic
942856444 2:180555322-180555344 TGGGAGCCACAGGGGGAAAGGGG + Intergenic
942942296 2:181632740-181632762 GAGGAGCCACAGGATGAGGGAGG - Intronic
944539538 2:200742737-200742759 ACTGACCCACAGGGAGATGGGGG + Intergenic
946256922 2:218449153-218449175 ACGGTGCCTGAGGGTGAGGGAGG + Intronic
946631353 2:221672463-221672485 ACAGAGCCACAGAGGAAGGGTGG - Intergenic
946709975 2:222495656-222495678 TCTGAGCCACAGGGAGAAGGTGG - Intronic
947442268 2:230133647-230133669 GCAGAGCCACAGGGGCAGAGTGG - Intergenic
948867184 2:240782170-240782192 ACGGGGCCACAGGGGGAGGCGGG - Intronic
1168750639 20:279013-279035 ACGGAGGGACGGAGGGAGGGCGG + Intronic
1168750674 20:279093-279115 ACGGAGGGACGGAGGGAGGGAGG + Intronic
1168815059 20:730570-730592 AAGGAGCCAAGGAGGGAGGGAGG + Intergenic
1170603000 20:17855978-17856000 AGGGAGACAGAGAGGGAGGGAGG + Intergenic
1170888932 20:20363591-20363613 AGGGAACCAGAGGGCGAGGGAGG + Intergenic
1171813416 20:29763073-29763095 ACGGAGGGAAAGAGGGAGGGAGG + Intergenic
1171852137 20:30316403-30316425 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1171905096 20:30893861-30893883 ACGGAGACAAAGTGAGAGGGAGG - Intergenic
1172320628 20:33993347-33993369 GCGGAGCCACGGGTGGAGGGAGG - Intergenic
1173529252 20:43756059-43756081 ACGGAGCCACTGGAGCCGGGAGG - Intergenic
1173617595 20:44413139-44413161 ACAGAGCAGCAGTGGGAGGGAGG + Intronic
1173832410 20:46099712-46099734 ACGGAACCACGGGGGCGGGGAGG - Intergenic
1174221545 20:48959530-48959552 AAGGAGGGACAGAGGGAGGGAGG - Intronic
1174395106 20:50242559-50242581 TGGGAGCCACAGGAGGAAGGTGG - Intergenic
1174423749 20:50417497-50417519 ACTGAGGCACAGAGAGAGGGTGG + Intergenic
1174572370 20:51511188-51511210 AGGGAGCAACAGGGGGTGGTGGG - Intronic
1174574286 20:51525778-51525800 ACAGAGCCACAGAGGAAGTGGGG - Intronic
1174810888 20:53644747-53644769 AGGGAGGGACAGAGGGAGGGAGG - Intergenic
1175162604 20:57020267-57020289 ACGGAGCCACAGGATAAGGCAGG - Intergenic
1175804508 20:61820089-61820111 AGGAAGCCACAGCGGGAGGCAGG - Intronic
1175877673 20:62238247-62238269 CCTGAGCCAAAAGGGGAGGGAGG - Intronic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1176383978 21:6127845-6127867 AGGGAGGCAGAGAGGGAGGGAGG + Intergenic
1176514536 21:7774235-7774257 AAGGAGCCTCAGGTGGAGGGAGG - Intergenic
1177046872 21:16182490-16182512 ACGGAGGGACGGAGGGAGGGAGG - Intergenic
1177097051 21:16849135-16849157 ACTGAACCACAGAGGGAGTGGGG - Intergenic
1178521700 21:33292456-33292478 ACGGTGCGACAGGGGTAGAGGGG + Intronic
1178648649 21:34404759-34404781 AAGGAGCCTCAGGTGGAGGGAGG - Intronic
1178824667 21:36005031-36005053 AGGGAGAGGCAGGGGGAGGGGGG + Intergenic
1179250050 21:39664717-39664739 ACCCAGCCACAGGGGGTGGTGGG - Exonic
1179396488 21:41044963-41044985 AAGGAGCCAGAGGGGGAGGGAGG + Intergenic
1179739496 21:43410393-43410415 AGGGAGGCAGAGAGGGAGGGAGG - Intergenic
1179913045 21:44460306-44460328 ACTGAGTCACAGGGAGAGGCGGG - Exonic
1180338523 22:11600041-11600063 ACGGAGACAAAGTGAGAGGGAGG - Intergenic
1181368325 22:22397154-22397176 AGAGAGACACAGGGTGAGGGAGG - Intergenic
1181376860 22:22465615-22465637 AGAGAGACACAGGGTGAGGGAGG - Intergenic
1181387850 22:22558235-22558257 ACGGAGACAGAGGGTGGGGGAGG + Intronic
1181523251 22:23461064-23461086 ATGGAGGCACAGGGGCTGGGGGG + Intergenic
1181831555 22:25564592-25564614 GCGGAGACCGAGGGGGAGGGAGG + Intergenic
1182031598 22:27163297-27163319 AGGGAGGGAAAGGGGGAGGGAGG + Intergenic
1182427526 22:30282828-30282850 ACGGTCCCTCAGGGAGAGGGAGG - Intergenic
1182698111 22:32209887-32209909 AGGGAGGGACAGGGGGAGTGGGG - Intergenic
1182751707 22:32646821-32646843 ACAGAACCACAGAGGGAGAGGGG - Intronic
1183056219 22:35307715-35307737 ACGGAGCCAGGGGAGAAGGGAGG + Intronic
1183074639 22:35419232-35419254 ACTGAGACCCAGAGGGAGGGAGG - Intronic
1183112418 22:35660095-35660117 ACAGAGCCACAGGCGGAGTTAGG + Exonic
1183392331 22:37552554-37552576 AGGGAGCCAGAGGGGTTGGGGGG + Intergenic
1183418747 22:37697775-37697797 ACAGAGCCCCAGGGGGAGGGTGG - Intronic
1183477012 22:38041247-38041269 GGGCAGGCACAGGGGGAGGGAGG + Intronic
1183535471 22:38398427-38398449 CCGGAGCCACAGGTAAAGGGGGG - Intronic
1183663331 22:39234003-39234025 CGGGAGCCACGGAGGGAGGGAGG + Intronic
1183912670 22:41091527-41091549 AGGGAGCCACAGGGTGACGCCGG + Intergenic
1184058334 22:42067066-42067088 ACGTAGGCAAACGGGGAGGGTGG - Intronic
1184238996 22:43201913-43201935 ACGGCTCCACAAAGGGAGGGAGG + Exonic
1184409938 22:44320656-44320678 AGGGGGTCACAGGGGGAGGGCGG - Intergenic
949518652 3:4829861-4829883 CCTGAGGCTCAGGGGGAGGGAGG - Intronic
950581206 3:13863246-13863268 GCTGGGCCACAGGTGGAGGGAGG - Intronic
951187877 3:19735345-19735367 AGGGAGAAAGAGGGGGAGGGAGG - Intergenic
952195211 3:31068303-31068325 GTGGAGTCACAGAGGGAGGGAGG - Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
952919192 3:38273388-38273410 ACGCACACACAGAGGGAGGGAGG - Intronic
953906445 3:46870664-46870686 ACATAGCCACACTGGGAGGGTGG - Intronic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
955032727 3:55236831-55236853 AGAGTGCCACAGGGAGAGGGTGG + Intergenic
955043715 3:55340166-55340188 AAGGAGCCACACAGGGAGGTGGG + Intergenic
955830485 3:62996390-62996412 ACGGACAGACAGAGGGAGGGAGG + Intergenic
956062315 3:65360047-65360069 TCCGAGGTACAGGGGGAGGGTGG - Intronic
956643431 3:71435353-71435375 ACGGAGGGACGGAGGGAGGGAGG + Intronic
958144973 3:89612494-89612516 AGGGAGGGACAGAGGGAGGGAGG - Intergenic
958532925 3:95357389-95357411 ACGGCAGCATAGGGGGAGGGAGG - Intergenic
960054161 3:113264806-113264828 TAGGAGGCACGGGGGGAGGGGGG + Intronic
960747730 3:120908387-120908409 AGGGAGCCACAGCTGGACGGCGG - Intronic
961324145 3:126100201-126100223 ACGTGGCAAGAGGGGGAGGGAGG - Intronic
962481266 3:135800637-135800659 AAGGAGGCACAGTGGCAGGGGGG - Intergenic
963066381 3:141267826-141267848 AGGGAGACAGAGAGGGAGGGAGG - Intronic
963234940 3:142947307-142947329 AAGAAGCCACAGGAGGAGGAAGG + Intergenic
965520963 3:169667920-169667942 ATGGAGCAAGATGGGGAGGGAGG + Intergenic
965678965 3:171230843-171230865 ATGGAGCCACAGGGGAAGGAAGG - Intronic
967830103 3:193911398-193911420 GCACAGCCACAGGGGAAGGGTGG + Intergenic
968283085 3:197491807-197491829 AGGGAGGCACAGGGTAAGGGTGG + Intergenic
968359818 3:198139005-198139027 ACAGAGCCTCATGGGAAGGGTGG - Intergenic
968593185 4:1469862-1469884 ATGGAGTCACATGGGTAGGGCGG - Intergenic
968626329 4:1628167-1628189 AGGGTGGCATAGGGGGAGGGTGG + Intronic
968626337 4:1628183-1628205 AGGGTGGCACGGGGGGAGGGTGG + Intronic
968626367 4:1628250-1628272 AGGGTGCCACGGGGGGAGGGTGG + Intronic
968626483 4:1628529-1628551 AGGGTGGCACGGGGGGAGGGTGG + Intronic
968626573 4:1628742-1628764 AGGGTGCCATGGGGGGAGGGTGG + Intronic
968626594 4:1628787-1628809 AGGGTGCCATGGGGGGAGGGTGG + Intronic
968947352 4:3672243-3672265 AGGGAGGCAGAGGGGGAGGGAGG - Intergenic
969322305 4:6419853-6419875 ACAGAGACACAGGGAGAGGAAGG - Intronic
969502866 4:7564262-7564284 AGGGGGCCACAGGGGCAGCGTGG - Intronic
969668501 4:8575957-8575979 AGGGAGAGAGAGGGGGAGGGAGG - Intronic
969903527 4:10371959-10371981 GTGGAGCCACAGGCAGAGGGAGG - Intergenic
970131390 4:12875593-12875615 ATGAAGACACAGGGGGAAGGTGG + Intergenic
972924152 4:43983577-43983599 AGGGAGGGACAGAGGGAGGGAGG + Intergenic
973968920 4:56191396-56191418 AGGGAGGAACAGAGGGAGGGAGG - Intronic
974086402 4:57265360-57265382 CAGGAGCCAGAGAGGGAGGGAGG + Intergenic
975862482 4:78692140-78692162 ACTGAACCACAGGGGATGGGAGG + Intergenic
976267242 4:83195717-83195739 ACAGAGACAGAGGGGGGGGGGGG - Intergenic
978071628 4:104479778-104479800 ACGGAGGAACAGAGGGAGGGAGG - Intronic
979059946 4:116044643-116044665 ACAGTGCCCCAGGGGTAGGGAGG + Intergenic
979618913 4:122776155-122776177 GGGGAGCCAGAGAGGGAGGGAGG + Intergenic
981800441 4:148649021-148649043 AAGGAGCTGAAGGGGGAGGGAGG + Intergenic
982967344 4:161929123-161929145 AGAGAGCAACAGAGGGAGGGAGG - Intronic
983559220 4:169084483-169084505 CCTGTGCCACAGGGGGAGGCAGG + Intergenic
983825017 4:172248870-172248892 ACAGTTCCACAGGGGTAGGGAGG - Intronic
983966580 4:173820195-173820217 ACGGAGGGACGGAGGGAGGGAGG - Intergenic
985129700 4:186726904-186726926 ACGCAGCCGAAGGAGGAGGGCGG - Intergenic
985595888 5:787615-787637 ACGGAGGCACGGGGAGCGGGGGG + Intergenic
985653853 5:1119875-1119897 AAGCAGCCACAGGGGGCAGGTGG - Intergenic
985851270 5:2390632-2390654 CCTGGGCCACAGGGGGAGGAAGG + Intergenic
985894024 5:2738730-2738752 CCGGAGGCACAGGAGGAGGGAGG - Intergenic
985976237 5:3420607-3420629 ATGGGGTCACAGGGGGATGGTGG + Intergenic
985976267 5:3420701-3420723 ATGGGGTCACAGGGGGATGGTGG + Intergenic
987383599 5:17308841-17308863 AGAGAGACAGAGGGGGAGGGAGG - Intergenic
988434632 5:31159504-31159526 GCGGAGATTCAGGGGGAGGGAGG - Intergenic
988514328 5:31891664-31891686 ACTGAGCCACCGAGGCAGGGAGG + Intronic
989674699 5:43960108-43960130 CCGGGGCCTCAGGGGGTGGGGGG - Intergenic
989677177 5:43985496-43985518 CAGGAGCCACAGAGCGAGGGGGG + Intergenic
990305755 5:54492835-54492857 AAGGAGCCAGAGGGGCAAGGAGG - Intergenic
990477334 5:56174073-56174095 GGGGAGCCACAGGGAGATGGGGG + Intronic
991132906 5:63145585-63145607 ACGGTGCAACAGGGGGAGACAGG - Intergenic
991172306 5:63642628-63642650 AGGGAGGAACAGAGGGAGGGAGG - Intergenic
993806195 5:92412899-92412921 ACGGAGCAAGAGGGAGAGAGAGG + Intergenic
996094860 5:119387771-119387793 ACAGAGACAGAGAGGGAGGGAGG + Intronic
997180101 5:131819443-131819465 GAGGAGGGACAGGGGGAGGGAGG + Intronic
997431647 5:133845012-133845034 GTGGAGACACAGGGGGACGGCGG - Intergenic
997431908 5:133846750-133846772 ACAGAGCCTCCTGGGGAGGGGGG + Intergenic
997616375 5:135248976-135248998 AGGGAGCCACAAGGGGAGAAAGG + Intronic
998184292 5:139966976-139966998 GTGGAGCCACTGGGGGAGGCTGG - Intronic
998371496 5:141664879-141664901 ACTGAGCCAATGGGGGTGGGGGG - Intronic
998478493 5:142441617-142441639 TAGGAGCCAGAGGAGGAGGGAGG + Intergenic
998501275 5:142635130-142635152 GCAGAGCCACAGGGGGAGCCAGG - Intronic
999191873 5:149754314-149754336 ACGGAGCTGCCAGGGGAGGGGGG - Intronic
999383645 5:151139388-151139410 ACGGAGCAACAGGCAGAGGCAGG - Exonic
999425519 5:151484869-151484891 ACTGAGCCCCAGGGAGAGGGTGG - Intronic
1001408708 5:171495295-171495317 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1002819396 6:710894-710916 ACGCAGGCACAGGGTGAGGGTGG + Intergenic
1003835595 6:10069372-10069394 CAGGAGGCAGAGGGGGAGGGTGG - Intronic
1005224018 6:23620247-23620269 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1006128703 6:31855352-31855374 AGGGAGACAGAGGGAGAGGGAGG + Intergenic
1006342080 6:33452520-33452542 AGGGGGCCACCGGGGCAGGGAGG + Exonic
1006359460 6:33579374-33579396 AAGGAGCTACGGGGGGTGGGAGG - Intronic
1006425134 6:33958945-33958967 AGGGATCCACAGAGGAAGGGGGG - Intergenic
1006945783 6:37783700-37783722 ATGGAGAGACAGGGGCAGGGAGG - Intergenic
1007494267 6:42248773-42248795 ACGGAGCCTCAGGGGGGCTGGGG + Intronic
1010134264 6:72532091-72532113 AGGGAGCCACAGGGAGTGGCAGG - Intergenic
1012956837 6:105580057-105580079 ATGGAGAAACATGGGGAGGGGGG - Intergenic
1015592357 6:134834050-134834072 ACAGAGAGAAAGGGGGAGGGAGG + Intergenic
1015959309 6:138631006-138631028 ACGCTGCCACTGGGGGATGGTGG - Intronic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1016423850 6:143913380-143913402 ATGGAGCCTCAAGGGGAGAGTGG - Intronic
1017327690 6:153158729-153158751 ACTGAATCACAGGGGGAGGGAGG + Intergenic
1018740153 6:166722383-166722405 GAGGAGCCGCAGGGGGTGGGAGG + Intronic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1018860407 6:167707088-167707110 ACGGGGCCACATGGGAAGGCCGG - Intergenic
1019260171 7:77643-77665 ACAGAGCCTCATGGGAAGGGTGG + Intergenic
1019416713 7:931028-931050 ACGGAGGGACTGAGGGAGGGAGG + Intronic
1019500970 7:1364600-1364622 ACTGAGGCCCAGGGGGAGTGAGG - Intergenic
1019588081 7:1815493-1815515 ATGGAGGCACAGGGGCTGGGGGG - Intergenic
1020092326 7:5348672-5348694 CAGGAGCCAGAGGGAGAGGGAGG + Intronic
1020130583 7:5556595-5556617 TCGGAGCCATGGGGGGAAGGGGG + Intronic
1022193451 7:28040549-28040571 ACGGTGCCACAGTGGGGAGGTGG + Intronic
1022256257 7:28661425-28661447 AGGGAGCCAGAGGGGTGGGGAGG - Intronic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1023138534 7:37077757-37077779 GAGGAGCCACAGGTGGAGAGAGG + Intronic
1023691551 7:42794222-42794244 AAGAAGCCACAGGGAGTGGGTGG + Intergenic
1024214149 7:47232345-47232367 GAGGAGCCAAAGGGGGAGGATGG + Intergenic
1025263799 7:57439675-57439697 TGGGATCCACAGGGGGAAGGAGG + Intergenic
1025635435 7:63316435-63316457 TGGGATCCACAGGGGGAAGGAGG - Intergenic
1025647260 7:63431735-63431757 TGGGATCCACAGGGGGAAGGAGG + Intergenic
1025992854 7:66508708-66508730 AGGGAGGCAGAGAGGGAGGGAGG - Intergenic
1026201424 7:68217949-68217971 ATAGAGCCACAGGGAGAGGTTGG - Intergenic
1027141629 7:75661790-75661812 TTGGAGCCACTGGGGGAGGATGG + Intronic
1027165311 7:75829978-75830000 AGGGAGCCCCAGGGGGAGGCAGG + Intergenic
1027165832 7:75833766-75833788 AGGGAGCCCCAGGGGGAGGCAGG - Intergenic
1029103179 7:98151581-98151603 ACGCTGCCACAGGGGGAATGGGG - Intronic
1029514691 7:101017867-101017889 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514712 7:101017908-101017930 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514733 7:101017949-101017971 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514754 7:101017990-101018012 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514775 7:101018031-101018053 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514817 7:101018112-101018134 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514861 7:101018196-101018218 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514975 7:101018464-101018486 AGGGAGTCCCAGGGGGAGGGAGG - Intronic
1029514986 7:101018484-101018506 AGGGAACCCCAGGGGGAGGGAGG - Intronic
1030301524 7:107979230-107979252 ACGGAGCCTGAAGGGGAGGGAGG - Intronic
1030316436 7:108119604-108119626 AGGAAGGCAGAGGGGGAGGGAGG + Intronic
1031023082 7:116649665-116649687 ACTGAGACATAGGGGCAGGGAGG - Intergenic
1034064220 7:148120883-148120905 AAGGAGCCTCATGGAGAGGGAGG + Intronic
1034532451 7:151704825-151704847 AGGGAGGCACAGGGAGAGCGAGG + Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035019581 7:155792597-155792619 GTGGGGCCACGGGGGGAGGGGGG - Intergenic
1035255371 7:157622512-157622534 AAAGAGACACAGAGGGAGGGAGG + Intronic
1035467910 7:159091705-159091727 TCGGTGCCACAGGAGGAGGCTGG + Intronic
1036690254 8:10940633-10940655 TGGGAGCCCCAGGAGGAGGGTGG - Intronic
1037910588 8:22741561-22741583 ACAGAGCCCCAGGGAGAGGAAGG + Intronic
1037962056 8:23105179-23105201 ACAGAGCCAGAGGGGGAGCACGG - Intronic
1038058640 8:23886948-23886970 CCAGAGCTACAGGGGGAGGAAGG + Intergenic
1042567518 8:70127541-70127563 ACCGAGTCAGAGGTGGAGGGTGG + Intronic
1045158039 8:99501883-99501905 AGGGAGGGACAGAGGGAGGGAGG - Intronic
1047511611 8:125520256-125520278 GAGGAGCCACAGGAGGAAGGAGG + Intergenic
1048508518 8:135042079-135042101 ACAGAGTCTCAGGGGGAGGCAGG + Intergenic
1048551911 8:135441433-135441455 AGGGAGCCACAGGAGGAAGGAGG + Intergenic
1048579490 8:135719370-135719392 ATGGAGGCTGAGGGGGAGGGAGG + Intergenic
1048709659 8:137195187-137195209 AGGGAGACAGAGCGGGAGGGAGG + Intergenic
1049014119 8:139907554-139907576 ATGGAGGCAGAGAGGGAGGGAGG + Intronic
1049355068 8:142183455-142183477 CCTGAGCCACAGGTGGTGGGAGG - Intergenic
1049398524 8:142413049-142413071 GGGGTGCCTCAGGGGGAGGGCGG + Intergenic
1049572796 8:143377558-143377580 ACTGAGGCCCAGAGGGAGGGAGG + Intronic
1049775284 8:144401145-144401167 ACCCAGCTGCAGGGGGAGGGAGG + Intronic
1049789782 8:144467265-144467287 TCGAAGCCCCAGGGGGAGGCAGG + Exonic
1049997627 9:1046962-1046984 AGGGAGGCAGAGGGGGAAGGGGG + Intergenic
1050339350 9:4620300-4620322 ATGAAGCCACAGGAGGAAGGAGG - Intronic
1052352662 9:27473317-27473339 AGGGAGGCAAAGGGGGAGGGTGG + Intronic
1052988875 9:34506922-34506944 CTGGAGCCACTGGAGGAGGGAGG + Intronic
1053157739 9:35792148-35792170 ACGGGGTGGCAGGGGGAGGGAGG - Exonic
1053554228 9:39118307-39118329 AGGGAGCTATATGGGGAGGGTGG - Intronic
1053789918 9:41679661-41679683 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054178257 9:61891350-61891372 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054475012 9:65566204-65566226 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054659272 9:67689474-67689496 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1056830869 9:89916325-89916347 ACAGAGACACAGGGGGAGCTAGG - Intergenic
1057316806 9:93974456-93974478 ATGGGGCCACGGGGGGGGGGGGG + Intergenic
1057928217 9:99171182-99171204 GCTGAGCCCCAGGGGGAGGAAGG - Intergenic
1059613573 9:115924694-115924716 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059613578 9:115924710-115924732 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059877585 9:118652667-118652689 AGGGAGACAGAGAGGGAGGGAGG + Intergenic
1060102234 9:120850769-120850791 ACAGAGATACTGGGGGAGGGGGG + Intergenic
1060410919 9:123399673-123399695 AGGGAGCCAGAGAGGAAGGGTGG + Intronic
1060477249 9:123995961-123995983 TCAGAGCCACATGGGCAGGGTGG + Intergenic
1060667873 9:125443716-125443738 AGGCAGGCACAGGGGGATGGGGG - Intronic
1060775087 9:126367246-126367268 AGGGAGCAAGAGGGGGAGCGTGG - Intronic
1060908724 9:127331573-127331595 ACAGAGGAACAGGGGCAGGGAGG - Intronic
1060937514 9:127524233-127524255 AAGTGTCCACAGGGGGAGGGAGG + Intronic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061826180 9:133259703-133259725 TCGGAGCCACAGGAGGAAAGAGG + Intronic
1062051770 9:134451087-134451109 ACAGAGACACATGGGGAGAGAGG + Intergenic
1062058748 9:134483254-134483276 AGGCAGCCTCAGGGGGAGGCAGG - Intergenic
1062136795 9:134933384-134933406 ACGGAGCCAGCGGGGCAGGGTGG - Intergenic
1062232047 9:135487180-135487202 ACGCAGCCAGAGGGCCAGGGGGG + Exonic
1062699084 9:137889868-137889890 AAGGAGGCAGAGAGGGAGGGGGG - Intronic
1062744521 9:138202826-138202848 ACAGAGCCTCATGGGAAGGGTGG - Intergenic
1203787660 EBV:136798-136820 AAGGAGGCACGGGTGGAGGGGGG - Intergenic
1185734276 X:2485549-2485571 AGGGAGGGACAGAGGGAGGGAGG + Intronic
1186045490 X:5532436-5532458 AGGGAGAGAGAGGGGGAGGGAGG + Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1187126796 X:16461911-16461933 AGGGAGGGAAAGGGGGAGGGAGG + Intergenic
1187682826 X:21785268-21785290 ACGGAGCTTCAGGAGGAGGCTGG + Intergenic
1189298302 X:39934624-39934646 AGGCAGCCACAGGGGCTGGGAGG - Intergenic
1190303004 X:49067347-49067369 AGGGAGCCAGAGGGGCAGGCGGG - Exonic
1191251101 X:58260551-58260573 AGGAAGCCCCAGGGGGAAGGGGG + Intergenic
1193949380 X:87778949-87778971 ACGGAGCACCTGGGGGAAGGGGG + Intergenic
1196398277 X:115288942-115288964 AGGGAGGGACAGAGGGAGGGAGG + Intergenic
1196793139 X:119482154-119482176 ACGGAGGCCCAGAGGAAGGGAGG + Intergenic
1198395122 X:136212462-136212484 AAGGAGCCCCACGGGGAGAGGGG + Intergenic
1199296480 X:146164641-146164663 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1201074244 Y:10175187-10175209 ACGGAGGGAAAGAGGGAGGGAGG - Intergenic
1201146249 Y:11066972-11066994 AGGGAGGCAGAGGGAGAGGGAGG + Intergenic
1201540081 Y:15096565-15096587 ATGGAGACACATGGAGAGGGAGG - Intergenic