ID: 1138631652

View in Genome Browser
Species Human (GRCh38)
Location 16:58299943-58299965
Sequence ACCAGAGGGCGCCACTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138631647_1138631652 9 Left 1138631647 16:58299911-58299933 CCAGACAGAAGTTGCTTCTGCCT 0: 1
1: 0
2: 2
3: 21
4: 206
Right 1138631652 16:58299943-58299965 ACCAGAGGGCGCCACTAACCAGG 0: 1
1: 1
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138631652 Original CRISPR ACCAGAGGGCGCCACTAACC AGG Intronic