ID: 1138631652 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:58299943-58299965 |
| Sequence | ACCAGAGGGCGCCACTAACC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 76 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 6, 4: 68} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1138631647_1138631652 | 9 | Left | 1138631647 | 16:58299911-58299933 | CCAGACAGAAGTTGCTTCTGCCT | 0: 1 1: 0 2: 2 3: 21 4: 206 |
||
| Right | 1138631652 | 16:58299943-58299965 | ACCAGAGGGCGCCACTAACCAGG | 0: 1 1: 1 2: 0 3: 6 4: 68 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1138631652 | Original CRISPR | ACCAGAGGGCGCCACTAACC AGG | Intronic | ||