ID: 1138633767

View in Genome Browser
Species Human (GRCh38)
Location 16:58320238-58320260
Sequence AGCTATCCCATCACACTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138633767_1138633771 0 Left 1138633767 16:58320238-58320260 CCCATCAGTGTGATGGGATAGCT 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1138633771 16:58320261-58320283 TGTGGCTCAGTGGATAAAATTGG 0: 1
1: 0
2: 0
3: 12
4: 163
1138633767_1138633773 24 Left 1138633767 16:58320238-58320260 CCCATCAGTGTGATGGGATAGCT 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG 0: 1
1: 0
2: 2
3: 12
4: 134
1138633767_1138633772 18 Left 1138633767 16:58320238-58320260 CCCATCAGTGTGATGGGATAGCT 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1138633772 16:58320279-58320301 ATTGGTTCTATCCTCTGCACTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1138633767_1138633774 27 Left 1138633767 16:58320238-58320260 CCCATCAGTGTGATGGGATAGCT 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1138633774 16:58320288-58320310 ATCCTCTGCACTGGAACAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 128
1138633767_1138633770 -10 Left 1138633767 16:58320238-58320260 CCCATCAGTGTGATGGGATAGCT 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1138633770 16:58320251-58320273 TGGGATAGCTTGTGGCTCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138633767 Original CRISPR AGCTATCCCATCACACTGAT GGG (reversed) Intronic