ID: 1138633768

View in Genome Browser
Species Human (GRCh38)
Location 16:58320239-58320261
Sequence AAGCTATCCCATCACACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138633768_1138633771 -1 Left 1138633768 16:58320239-58320261 CCATCAGTGTGATGGGATAGCTT 0: 1
1: 1
2: 1
3: 13
4: 86
Right 1138633771 16:58320261-58320283 TGTGGCTCAGTGGATAAAATTGG 0: 1
1: 0
2: 0
3: 12
4: 163
1138633768_1138633773 23 Left 1138633768 16:58320239-58320261 CCATCAGTGTGATGGGATAGCTT 0: 1
1: 1
2: 1
3: 13
4: 86
Right 1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG 0: 1
1: 0
2: 2
3: 12
4: 134
1138633768_1138633772 17 Left 1138633768 16:58320239-58320261 CCATCAGTGTGATGGGATAGCTT 0: 1
1: 1
2: 1
3: 13
4: 86
Right 1138633772 16:58320279-58320301 ATTGGTTCTATCCTCTGCACTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1138633768_1138633774 26 Left 1138633768 16:58320239-58320261 CCATCAGTGTGATGGGATAGCTT 0: 1
1: 1
2: 1
3: 13
4: 86
Right 1138633774 16:58320288-58320310 ATCCTCTGCACTGGAACAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138633768 Original CRISPR AAGCTATCCCATCACACTGA TGG (reversed) Intronic