ID: 1138633773

View in Genome Browser
Species Human (GRCh38)
Location 16:58320285-58320307
Sequence TCTATCCTCTGCACTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138633768_1138633773 23 Left 1138633768 16:58320239-58320261 CCATCAGTGTGATGGGATAGCTT 0: 1
1: 1
2: 1
3: 13
4: 86
Right 1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG 0: 1
1: 0
2: 2
3: 12
4: 134
1138633767_1138633773 24 Left 1138633767 16:58320238-58320260 CCCATCAGTGTGATGGGATAGCT 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG 0: 1
1: 0
2: 2
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138633773 Original CRISPR TCTATCCTCTGCACTGGAAC AGG Intronic