ID: 1138633773

View in Genome Browser
Species Human (GRCh38)
Location 16:58320285-58320307
Sequence TCTATCCTCTGCACTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138633768_1138633773 23 Left 1138633768 16:58320239-58320261 CCATCAGTGTGATGGGATAGCTT 0: 1
1: 1
2: 1
3: 13
4: 86
Right 1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG 0: 1
1: 0
2: 2
3: 12
4: 134
1138633767_1138633773 24 Left 1138633767 16:58320238-58320260 CCCATCAGTGTGATGGGATAGCT 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG 0: 1
1: 0
2: 2
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138633773 Original CRISPR TCTATCCTCTGCACTGGAAC AGG Intronic
900430227 1:2597868-2597890 TCTGGCCTCTGCACTGGCACTGG + Intronic
900642894 1:3695771-3695793 TCTATCCCCAGCACTGCAGCCGG - Intronic
902072993 1:13757412-13757434 TCGATCCTCTGCACTGCAGAGGG - Intronic
903693353 1:25189995-25190017 TTTGTCCTCTGCCCTGGACCTGG + Intergenic
904618453 1:31762332-31762354 AGTATCCTCTGCACTGCTACTGG - Intronic
906877110 1:49551680-49551702 GCTATCACCTCCACTGGAACAGG - Intronic
908775234 1:67633186-67633208 TCTGTCCTCTGCACAAGACCTGG + Intergenic
909907752 1:81220756-81220778 ACTTTGCTCTGCACTGGAGCGGG - Intergenic
911445245 1:97984418-97984440 TCAGCCCTCTGCACTGGACCAGG + Intergenic
913150896 1:116041881-116041903 TCTATCCAATGCTCTGCAACTGG - Intronic
917869399 1:179228968-179228990 TCTGTCCTCTACTCTGGGACGGG - Intronic
924767006 1:247042855-247042877 CCTATTCTCTGTACTGTAACTGG + Intronic
924823133 1:247513497-247513519 ACTATCCGCTGCCCTGGAAAGGG - Intronic
1062962317 10:1581924-1581946 TGTTTTCTCTGCCCTGGAACAGG + Intronic
1067967273 10:50926784-50926806 TATGTCATCTGCACTGCAACAGG + Intergenic
1072317248 10:94214981-94215003 TTTCTCATCTGCACTGGAATGGG - Intronic
1074688724 10:115983149-115983171 TCTATCCTGGCCACTGTAACAGG + Intergenic
1076571150 10:131433888-131433910 TCTAGTCCCTGCACTGGAGCAGG + Intergenic
1078192509 11:9103628-9103650 TCTGGCCTGAGCACTGGAACAGG - Intronic
1081214442 11:40377900-40377922 TCTATCTTCTGCACTTTAAGAGG - Intronic
1081790483 11:45779794-45779816 TTTGGCCTCTGCACAGGAACTGG + Intergenic
1083333405 11:61909515-61909537 CCTGCCCTCTGCTCTGGAACCGG + Intronic
1083482797 11:62960524-62960546 TCTCTTCACTACACTGGAACAGG + Intronic
1085707864 11:78802646-78802668 TCTAGCCTCATCACAGGAACAGG + Intronic
1087115565 11:94520823-94520845 TTAATTCTCTGCACTGAAACCGG + Intergenic
1092062670 12:5564057-5564079 TCTATCCTCTACACTAGAGACGG + Intronic
1093989576 12:25574774-25574796 TCTATTCTGTGCACTGGAGAAGG - Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1099058522 12:77875964-77875986 TCTATCCTATGCCTTGGAAAAGG - Intronic
1100290941 12:93214629-93214651 TCCATCACCTCCACTGGAACAGG - Intergenic
1101136775 12:101751912-101751934 TTTATCCTCAGCACAGCAACAGG - Intronic
1101703432 12:107197191-107197213 TTTATCCTCTACATTGGAAGAGG + Intergenic
1106945801 13:34826190-34826212 TCTATCCTCAGCTCTGCCACTGG + Intergenic
1107042585 13:35965542-35965564 TCTGTCCTTTGCACAGCAACTGG - Intronic
1109065102 13:57677113-57677135 TCAATCCTCAGCACTTGAAACGG - Intronic
1111845834 13:93507352-93507374 TCTAAGCTCTGCTGTGGAACAGG - Intronic
1113412978 13:110106714-110106736 GCTGTCCTTTGCACGGGAACAGG + Intergenic
1113579828 13:111421019-111421041 TCGATTCTCTGCACTTGTACTGG + Intergenic
1115589627 14:34851550-34851572 TCTGTCCCCTCCCCTGGAACTGG - Intronic
1118867948 14:69718090-69718112 TCTTTCCCCTGCATTGGAAGTGG + Intergenic
1120592247 14:86390237-86390259 ACTTTGCTCTGCACTGGAGCAGG - Intergenic
1124159677 15:27256742-27256764 CCTATCCTATGCACAGGAATGGG + Intronic
1124505426 15:30268623-30268645 TTGATCCTCTGCATTGGACCAGG - Intergenic
1124738126 15:32270008-32270030 TTGATCCTCTGCATTGGACCAGG + Intergenic
1125059267 15:35399535-35399557 TTTATCCACTGTGCTGGAACAGG - Intronic
1125164022 15:36681468-36681490 TCTATTCTCTCCTCTGAAACTGG - Intronic
1125273447 15:37966092-37966114 TCCATCATTTGCATTGGAACTGG + Intronic
1127910021 15:63409127-63409149 TCTAGCCTTTGGACTGGGACTGG - Intergenic
1128278670 15:66376053-66376075 TCCAGCCTTTGCACTGGAAATGG + Intronic
1129070132 15:72944048-72944070 TCTTTCTTCTGAATTGGAACTGG - Intergenic
1131363712 15:91818923-91818945 TCTCTCCCCTCCTCTGGAACTGG + Intergenic
1132221602 15:100109340-100109362 TCTATCCTTTGCAATGATACAGG + Intronic
1134020898 16:10920784-10920806 TCTAGTTTCTGCACTGGTACCGG + Intronic
1135201506 16:20441618-20441640 TCGATCCTTTGCACTCGGACAGG - Intergenic
1135356029 16:21769775-21769797 TCTTTCCTCTGCACATGAATTGG + Intergenic
1135454519 16:22585914-22585936 TCTTTCCTCTGCACATGAATTGG + Intergenic
1135830505 16:25768701-25768723 TCTCTCCTCTCCACTGAGACAGG - Intronic
1138391902 16:56676252-56676274 TCTATCCTCTGGAATGGAAATGG - Intronic
1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG + Intronic
1146790218 17:35746701-35746723 TCTCTCCACTGCCCTGCAACTGG - Intronic
1152085118 17:78213391-78213413 TGTGTCCTCTGCTTTGGAACAGG - Intergenic
1153613848 18:6915928-6915950 GCTGTCCTGTGCACTGGAGCGGG - Intergenic
1156910353 18:42404608-42404630 TGTATCCTCTGCCTTGGAAAGGG + Intergenic
1160264004 18:77322924-77322946 TCTACCCTCTACACAGCAACTGG - Intergenic
1160901670 19:1431960-1431982 TCCATCCTCTGGCCTGGATCAGG + Intronic
927194679 2:20539364-20539386 TCTTTCCTCTGCACTAGGGCAGG + Intergenic
929726213 2:44430458-44430480 TCTATTCTCTGCACTGAAGGGGG - Intronic
930028288 2:47043129-47043151 TCCATCCTGTCCACTGCAACGGG - Intronic
935223741 2:101036156-101036178 TCTGTTCTCTGGACTGGAAATGG + Exonic
935832833 2:107018595-107018617 CCTGTCCTCTGCACTGGGCCAGG - Intergenic
936014283 2:108946011-108946033 TCCATTCTCTGCACTAGTACTGG + Intronic
939651378 2:144766897-144766919 ACTATCCTCTGCACAGGTAGGGG + Intergenic
941784346 2:169481126-169481148 TGTATCTCCTGCACTAGAACGGG - Intronic
942253386 2:174066925-174066947 TTTGTCCTCTACAATGGAACAGG + Intergenic
946125428 2:217558430-217558452 TCTAGCCTCAGCGCTGTAACAGG + Intronic
947353346 2:229269542-229269564 GCTACCCTCTGCACTTGAACAGG + Intronic
1171299846 20:24050603-24050625 TCTCTCCTCTGTCCTGGGACAGG + Intergenic
1179054365 21:37917038-37917060 TCTGTCCTGTCCACTGCAACTGG + Intergenic
1181621004 22:24091175-24091197 CCTCTCCTGTGCAGTGGAACTGG + Intronic
1183012419 22:34957822-34957844 GCTATTCTCTCCCCTGGAACTGG - Intergenic
1183318578 22:37149956-37149978 TCTATCCTCTGCACAGGAAGTGG - Exonic
950716732 3:14853134-14853156 GCTATCATTTGCACTGTAACTGG - Intronic
951509724 3:23487217-23487239 GCTTTGCTCTGCACTGGAGCAGG + Intronic
951538453 3:23760876-23760898 TCTATTCTCAGCACTGGCAGGGG + Intergenic
952100379 3:30005056-30005078 TCTATCTTCTGGACTGTAATAGG - Intronic
954966313 3:54614262-54614284 TCTATCCTCAGCAATGGAAGGGG - Intronic
959253032 3:103972510-103972532 TCTACCTTCTGCACTGGGGCAGG + Intergenic
968503222 4:960721-960743 TCTGTCCCCTGCCCTGGGACAGG - Exonic
970872171 4:20828597-20828619 CCCATCCTCTGCAATGGAATGGG + Intronic
971181991 4:24337375-24337397 TATATCCTCAGCACTGGCACAGG - Intergenic
973719092 4:53705369-53705391 CCTTCCCTCTGCACAGGAACAGG - Intronic
976850297 4:89536977-89536999 TCTATCCTCTGTCCTGGAAAAGG + Intergenic
983357669 4:166684344-166684366 TCTATTTTCTGCAGTGTAACTGG + Intergenic
983875457 4:172869802-172869824 TCTACCCTCTGCTCTAGAAATGG + Intronic
985829804 5:2219848-2219870 TGTATCCTCAGTCCTGGAACAGG - Intergenic
986058322 5:4161660-4161682 TCTGTCCTCTGCAATGGGACTGG + Intergenic
986195966 5:5536651-5536673 TCTGTCCTCTGCAATGCAGCTGG - Intergenic
992128090 5:73663475-73663497 TATATCCATTGCACTTGAACTGG + Intronic
992656578 5:78916321-78916343 CCTTTCTTCTGGACTGGAACAGG - Intronic
994247005 5:97489397-97489419 TCTTTGCTCTGCACTGGAGTGGG + Intergenic
1000447588 5:161343006-161343028 TGTATGCTCTGCACAGGTACAGG + Intronic
1000824313 5:166025528-166025550 TCTATTTCCTGCACTAGAACTGG - Intergenic
1005072546 6:21874926-21874948 TCTACCACCTCCACTGGAACAGG + Intergenic
1008375747 6:50789473-50789495 CCTATCCTCTGCTCTGGAGGGGG - Intergenic
1008468498 6:51856826-51856848 GGTATCCTCTGCCCTGGCACAGG + Intronic
1008473211 6:51907791-51907813 TCTAGCCTCTGCATTTTAACAGG + Intronic
1009582848 6:65558369-65558391 ACTTTGCTCTGCACTGGAGCAGG + Intronic
1010619950 6:78061944-78061966 CCCATCCTCTGCATTGGAAAAGG - Intergenic
1011822686 6:91271793-91271815 ACTATGCTCTGCACTGGAGCAGG + Intergenic
1012404657 6:98881252-98881274 TCTATCCTGTGCAATGAAAATGG + Intronic
1012535490 6:100291884-100291906 TCTTTCCTCTTCACAGGAACTGG - Intergenic
1012940312 6:105408513-105408535 GCTATCCTCTGTACTGCAAAGGG + Intergenic
1013438653 6:110139167-110139189 ACTTTGCTCTGCCCTGGAACAGG + Intronic
1016539836 6:145151967-145151989 TCTCTCTTCTGCACAGGTACTGG - Intergenic
1017258502 6:152361433-152361455 TCCATCCTCTTCACCTGAACTGG - Intronic
1022391812 7:29950209-29950231 ACTTTGCTCTGCACTGGAGCAGG - Intronic
1023901579 7:44485127-44485149 TCTATTTCCTGGACTGGAACTGG + Exonic
1026511064 7:71027703-71027725 TCTTTCCTCTTGCCTGGAACTGG - Intergenic
1028405399 7:90468613-90468635 TCTGTCCTCTGCATTGCAAATGG + Intronic
1028702592 7:93798472-93798494 TGTATACTCTCCACTTGAACTGG - Intronic
1030509135 7:110461641-110461663 TAGATACTCTGCACTGAAACAGG - Intergenic
1030936051 7:115585656-115585678 TCAACCATCTTCACTGGAACAGG + Intergenic
1033236835 7:139644750-139644772 TCTTTTCTCTGCACTGGCAAGGG + Intronic
1033723495 7:144086627-144086649 TCTATCCTGAGGACTGGGACAGG - Intergenic
1035747267 8:1971330-1971352 TCTGGCGTCAGCACTGGAACAGG + Intergenic
1039086619 8:33786677-33786699 ACTGTCCTCTGCAATGCAACAGG - Intergenic
1040838812 8:51761922-51761944 TCTATACTCTGCAGAGCAACTGG + Intronic
1042094012 8:65191874-65191896 TCTGTCCTCTGAACAGGAAGCGG - Intergenic
1045350337 8:101332471-101332493 TCTATCCTCTGTACAGGAAGGGG - Intergenic
1047816044 8:128463891-128463913 TTTATCCTTTGCTCTGGAAGTGG - Intergenic
1048831288 8:138479736-138479758 TGTATCCTCAGCACTGGACTTGG + Intronic
1049769289 8:144372444-144372466 CCTTTCCTCTGTAATGGAACAGG - Intergenic
1052795117 9:32916491-32916513 TCTATTTCCTGCACTGGAATAGG - Intergenic
1056508848 9:87283598-87283620 TCTGTTCTCTTCACTGAAACTGG + Intergenic
1057280484 9:93707864-93707886 TCTATTCTCTGCACTGACACTGG + Intergenic
1059969454 9:119650342-119650364 TCTTTCCTTTGCTCAGGAACAGG + Intergenic
1060376828 9:123122697-123122719 CATATCCTCTGCACGGGGACTGG - Exonic
1062615665 9:137394668-137394690 TTTATCCTCAGCACTGAATCTGG + Intronic
1186816021 X:13238876-13238898 TCAATACCCTGAACTGGAACTGG - Intergenic
1186908333 X:14135026-14135048 TGCATCCTCTCCACTGGGACAGG + Intergenic
1186963648 X:14763991-14764013 TCTATCTTTTGCACTGCACCAGG - Intergenic
1189603232 X:42649086-42649108 TCTATCATCTCCACTGGAACAGG + Intergenic
1196340689 X:114592841-114592863 TCTATGCTCTGCCCAGGAATTGG - Intronic
1196464879 X:115961164-115961186 TCTGCCATCTCCACTGGAACAGG + Intergenic
1196611798 X:117723716-117723738 TCTATTTTCTGCACTGCAACTGG - Intergenic
1197406948 X:126065217-126065239 ACTTTGCTCTGCACTGGAGCAGG - Intergenic
1200074950 X:153546272-153546294 TCCTCCCTCTGCACTGGGACGGG - Intronic