ID: 1138634692

View in Genome Browser
Species Human (GRCh38)
Location 16:58328376-58328398
Sequence GGGTGGGGATGGGGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22718
Summary {0: 1, 1: 2, 2: 44, 3: 807, 4: 21864}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138634692_1138634706 13 Left 1138634692 16:58328376-58328398 CCCATTTCTCCCCATCCCCACCC 0: 1
1: 2
2: 44
3: 807
4: 21864
Right 1138634706 16:58328412-58328434 TAATCTGCTTTCTGCATCTGTGG 0: 1
1: 4
2: 33
3: 251
4: 919
1138634692_1138634707 28 Left 1138634692 16:58328376-58328398 CCCATTTCTCCCCATCCCCACCC 0: 1
1: 2
2: 44
3: 807
4: 21864
Right 1138634707 16:58328427-58328449 ATCTGTGGATTTGCCTATTCTGG 0: 2
1: 95
2: 543
3: 1448
4: 2202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138634692 Original CRISPR GGGTGGGGATGGGGAGAAAT GGG (reversed) Intronic
Too many off-targets to display for this crispr