ID: 1138635225

View in Genome Browser
Species Human (GRCh38)
Location 16:58332969-58332991
Sequence TAAAAAACACAGATGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 1, 1: 1, 2: 10, 3: 87, 4: 780}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138635225_1138635230 11 Left 1138635225 16:58332969-58332991 CCCGGCTGCATCTGTGTTTTTTA 0: 1
1: 1
2: 10
3: 87
4: 780
Right 1138635230 16:58333003-58333025 ATGATTCTAAAATGCAGCCAAGG 0: 2
1: 16
2: 89
3: 310
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138635225 Original CRISPR TAAAAAACACAGATGCAGCC GGG (reversed) Intronic
901107511 1:6768696-6768718 TAAAAACCAAACTTGCAGCCGGG + Intergenic
901109363 1:6783323-6783345 TAAAAAAGACCGATACAGGCCGG - Intergenic
901188777 1:7391290-7391312 TAAAACATCCAGATACAGCCGGG - Intronic
901276061 1:7991831-7991853 TAAAAAACAAGGAAACAGCCTGG - Intergenic
901697377 1:11018482-11018504 TAAAAAAGAGAGATGGGGCCAGG - Intronic
901760037 1:11464838-11464860 TTAAAAATGCAGATTCAGCCGGG + Intergenic
902141884 1:14363652-14363674 TAAAAAACCCAGCTGCTGGCTGG - Intergenic
902314383 1:15606880-15606902 TAAAAAATACAAAAGAAGCCGGG + Intergenic
902318374 1:15641308-15641330 TTAAAAACACAAAATCAGCCAGG + Intronic
902339892 1:15776120-15776142 TAAAAAACACATATGGGGCCGGG + Intronic
902344310 1:15804791-15804813 TAAAAAACACAAATGGGGCTGGG - Intergenic
902355688 1:15897792-15897814 TAAAAAGCAAAAATGCGGCCAGG - Intronic
902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG + Intronic
902848513 1:19132475-19132497 TTAAAAATACATATTCAGCCAGG - Intronic
902996528 1:20229757-20229779 TAGAAAACTCAGGTGCAGGCCGG + Intergenic
903226627 1:21897422-21897444 AAAAAAACAAAGAGCCAGCCAGG + Intronic
903890447 1:26566783-26566805 GAAACAACACAGAGGGAGCCTGG - Intronic
903957006 1:27032596-27032618 AAAAAAATACAAAAGCAGCCGGG - Intergenic
903964744 1:27080104-27080126 AAAAACACACATTTGCAGCCAGG - Intergenic
904534917 1:31192867-31192889 TAAAAAATTTAGATGTAGCCTGG + Intronic
904687015 1:32267731-32267753 TAAAAAATACAGAATTAGCCGGG + Intronic
905019705 1:34800532-34800554 TAAAACAGAGAAATGCAGCCAGG + Intronic
905383534 1:37581956-37581978 TAAAAAAAAAAGATGTGGCCGGG - Intronic
905661866 1:39733700-39733722 TAAAAAATGTAAATGCAGCCAGG + Intronic
905806197 1:40879524-40879546 TAAAAAACACAAAATTAGCCAGG - Intergenic
906069272 1:43005896-43005918 GCACAAACACAGATGCAGACGGG - Intergenic
906076476 1:43055795-43055817 TAAAGAAAACAGATCCAGGCTGG - Intergenic
906314458 1:44777230-44777252 CTAAAAATACAGAAGCAGCCGGG - Intronic
906815272 1:48872326-48872348 TTCAAAACAAAGATGCAGCCTGG - Intronic
906995626 1:50790433-50790455 TTAAAAACACAAATAAAGCCGGG - Intronic
907250657 1:53136352-53136374 TAAAATACACAAATTTAGCCGGG - Intronic
907406296 1:54255457-54255479 TTAAAAACACAGATGGGGGCAGG + Intronic
908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG + Intergenic
908201303 1:61798492-61798514 TTAAAAACTGACATGCAGCCAGG - Intronic
908227234 1:62068159-62068181 TAACAAACTCAGATGCATCCAGG - Intronic
910315484 1:85877656-85877678 TTAAAAACACACATGAAGCTGGG - Intronic
910348404 1:86267914-86267936 TTAAAAAAAGATATGCAGCCAGG + Intergenic
910368002 1:86487214-86487236 AATAAAACACAGATGCACGCAGG - Intronic
910402357 1:86849962-86849984 TAAAGAAGACAGCTGCAGCTGGG - Intergenic
910773594 1:90852909-90852931 AAAAAAATACTGATTCAGCCTGG + Intergenic
910993290 1:93078092-93078114 TAAAAAAAGCAGATGCAGCCGGG - Intergenic
911006793 1:93234453-93234475 TAAAAAATACAAATGAGGCCAGG - Intronic
911125079 1:94333859-94333881 AAAAAAAGTCAGATGCAGCTGGG + Intergenic
911862522 1:102970851-102970873 TAAAAAACAAAAAAGTAGCCGGG + Intronic
912264347 1:108140837-108140859 AACAAAACACAGAAGAAGCCAGG + Intronic
914837330 1:151218539-151218561 TAAAAACCAAAGATGAGGCCGGG + Intronic
915198071 1:154205177-154205199 TTGAAAAAACTGATGCAGCCGGG - Intronic
915238813 1:154504776-154504798 TTAAAAACACAGATAAAGCCTGG + Intronic
915337516 1:155154590-155154612 TACAAAACACTGATGAGGCCGGG + Intergenic
915789604 1:158653723-158653745 TACAAAAAACACATGGAGCCAGG + Intronic
916744546 1:167674909-167674931 TAATAAAGACATATCCAGCCGGG + Intronic
916744790 1:167676795-167676817 TTAAAACCACTGAAGCAGCCAGG + Intronic
916842370 1:168613626-168613648 TAATAAAAACAGATGCAGATTGG - Intergenic
917341756 1:173986721-173986743 AAAAATACACAGAATCAGCCAGG - Intronic
917996697 1:180446745-180446767 TAAAAAACAGACATTTAGCCAGG + Intronic
918200392 1:182260884-182260906 TAAAGAATACAGATGTGGCCAGG - Intergenic
918305216 1:183239942-183239964 GAAAAAATACAGCGGCAGCCGGG - Intronic
919113779 1:193255294-193255316 TAAAAAATACAAATATAGCCAGG - Intergenic
919875688 1:201865502-201865524 TAGAAAAGACAGCTGCAGGCCGG - Intronic
919902365 1:202053650-202053672 AAAAAATAACAGATGCAGCCAGG + Intergenic
920058495 1:203211427-203211449 TAAAAAACAAGGATAAAGCCAGG + Intergenic
920481580 1:206327164-206327186 TAAAAAACACAAAATTAGCCGGG + Intronic
920549816 1:206848807-206848829 TAAAAAACTCTGATGTGGCCGGG - Intergenic
921229756 1:213057234-213057256 TTAAAAAGACAGAGTCAGCCGGG - Intronic
922096988 1:222450960-222450982 AAAAAAACAAAAAGGCAGCCTGG + Intergenic
922402490 1:225274487-225274509 AAAAAATAACAGATGCGGCCGGG - Intronic
922621337 1:226990656-226990678 TCAAAACCACAGACGCAGCAGGG - Exonic
923243764 1:232111020-232111042 TTATAAACACAGACGCAGCATGG - Intergenic
923396333 1:233568735-233568757 TAAAAGACAAAGATGCAGCCAGG - Intergenic
923605719 1:235440688-235440710 AAAAAAATACAGATGCCGGCTGG - Intronic
923923562 1:238597535-238597557 TAAAAATCCAAGATGCAGGCCGG - Intergenic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924231436 1:241965280-241965302 TAAAAAATACAAAATCAGCCGGG + Intergenic
924759794 1:246972811-246972833 TAAAAAACCCAGAGGCTGCCGGG - Intronic
1063156152 10:3381082-3381104 CAAAAAGCAAAGAAGCAGCCAGG + Intergenic
1063258292 10:4353479-4353501 TAACAAACACAGATGGATGCTGG - Intergenic
1063715417 10:8521847-8521869 TAAAAAACACAGGTCTAGCTTGG + Intergenic
1064010336 10:11730350-11730372 TAAAAACCCCAAATTCAGCCAGG + Intergenic
1064173273 10:13052641-13052663 TAAAAAACCCACAGGCATCCTGG + Intronic
1064308928 10:14194313-14194335 TAAAAAACACGGAGGAGGCCGGG + Intronic
1065001223 10:21339217-21339239 TTAAAAACATGGAAGCAGCCAGG - Intergenic
1065673267 10:28145206-28145228 AAAAAGACACAGATACGGCCAGG - Intronic
1065730561 10:28706042-28706064 GAAAACACACAGCTTCAGCCGGG - Intergenic
1065880341 10:30032047-30032069 TTAAAAATACAGATGGAGCCGGG - Intronic
1066052660 10:31649562-31649584 TAAAAAAGACAGAGCCAGCTGGG + Intergenic
1066550097 10:36546647-36546669 TAAAAAAGATAAATGAAGCCTGG + Intergenic
1067115464 10:43432468-43432490 AAAGAACCACAGATGTAGCCAGG - Intergenic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1069432049 10:68346292-68346314 TAAAAAACAAGATTGCAGCCAGG + Intronic
1070261873 10:74864399-74864421 TAAAAAACACAAAATTAGCCGGG - Intronic
1070406429 10:76101573-76101595 TTAAAAACACAGAATTAGCCAGG + Intronic
1070622861 10:78027362-78027384 TAAATAACATAAATGCAGCCGGG + Intronic
1071664349 10:87539789-87539811 TAAGAACCACAGATGCAGTGAGG + Intronic
1072085284 10:92073332-92073354 TAAATGACACAGATACGGCCAGG - Intronic
1072238945 10:93477329-93477351 TAAAAAACACAAAATTAGCCGGG + Intronic
1072651406 10:97298645-97298667 TAAAACACAAAGATGCATCAAGG - Intergenic
1072856216 10:98949797-98949819 TAAAAAACACATGTGCTTCCAGG - Intronic
1072889264 10:99307280-99307302 TAAAACACACAGATAAATCCTGG - Intergenic
1072946613 10:99816260-99816282 CAAAAAACAGAGATGGAGGCCGG - Intronic
1073259000 10:102174513-102174535 TTAAAAACACACATACGGCCGGG - Intergenic
1073670105 10:105578779-105578801 TAGAAAACACAACTGCACCCAGG - Intergenic
1074139577 10:110660249-110660271 TAAAAAAAAAAGAAGCTGCCTGG + Intronic
1074195558 10:111181516-111181538 ACAGAATCACAGATGCAGCCTGG + Intergenic
1074205516 10:111279677-111279699 TAAAACACAAAGCTACAGCCAGG - Intergenic
1074396559 10:113102713-113102735 TAAAAAATACAGATATGGCCAGG - Intronic
1074552254 10:114455486-114455508 TAAAAAACACAGAGGAAAACAGG + Intronic
1075386507 10:122059210-122059232 TTAAAAACACAGATGGAGCCCGG - Intronic
1075825744 10:125355976-125355998 TAAATAACAGTAATGCAGCCGGG - Intergenic
1075876747 10:125813772-125813794 TAAGAAACTCAGAGCCAGCCAGG - Intronic
1076124026 10:127960726-127960748 CAAAAAATACAGAAACAGCCGGG + Intronic
1076568884 10:131418934-131418956 TAAAGTACTTAGATGCAGCCAGG + Intergenic
1077026138 11:440892-440914 CAAAAAAGACAGTTGCAGCCGGG - Intronic
1077917690 11:6621995-6622017 CAGCAAACACAGCTGCAGCCCGG - Exonic
1077931551 11:6738216-6738238 TACATACCACAGCTGCAGCCAGG + Intergenic
1078509026 11:11972152-11972174 TTAAAAACAAAGATGAAGGCAGG + Intronic
1078568275 11:12435769-12435791 AAAAAAACAGAGATATAGCCAGG - Intronic
1079619966 11:22541999-22542021 TAAAATATAGAGATGAAGCCAGG + Intergenic
1079687427 11:23377413-23377435 TCTATAACACAGATGCAGCAGGG + Intergenic
1079789176 11:24713989-24714011 TAAAAAAGACAGATTTGGCCAGG - Intronic
1080522898 11:33083081-33083103 TAAAATACAGAGATGTAGGCTGG - Intronic
1081096088 11:38937148-38937170 TAAAAAACAAAGATTGGGCCAGG - Intergenic
1081307185 11:41526994-41527016 TAAAAATAACAGATGCTGGCTGG - Intergenic
1081802376 11:45868921-45868943 TTAAAAACCTAGATACAGCCAGG - Intronic
1082220500 11:49629774-49629796 TAAAATACAAAAATTCAGCCGGG - Intergenic
1083114458 11:60446440-60446462 AAAAAAACACAGGTGGGGCCGGG + Intronic
1083943335 11:65910461-65910483 TCAAAGACACAGCTCCAGCCTGG + Intergenic
1084201317 11:67560318-67560340 TGAAAATCAAAGATGCAGGCCGG + Intergenic
1084912452 11:72401959-72401981 TAAAAAACACAGATCATGGCTGG + Intronic
1085009970 11:73132525-73132547 TAAAAAACTCAGGTGAAGACAGG + Intronic
1085086245 11:73669518-73669540 TAAAGAACAGAGATGGAGGCCGG + Intergenic
1086210872 11:84317106-84317128 CAAGCAACACAGCTGCAGCCGGG - Intronic
1086676131 11:89609431-89609453 TAAAAAACACAAATTTGGCCGGG + Intergenic
1087251514 11:95905389-95905411 TTAAAAACAAAAATGCAGGCTGG + Intronic
1088801023 11:113307230-113307252 TTAAAAACTTAGGTGCAGCCAGG - Intergenic
1089092134 11:115886689-115886711 TAACAAACACTGATTAAGCCTGG - Intergenic
1089421806 11:118337690-118337712 TTAAAAATATAAATGCAGCCAGG - Intergenic
1089785458 11:120904010-120904032 AAGACAACACAGAAGCAGCCAGG - Intronic
1090962529 11:131569875-131569897 TAGAAAACAGAGATACAGGCCGG - Intronic
1091048891 11:132350187-132350209 TAAAGAACATAAATGCAGTCAGG - Intergenic
1093632718 12:21429378-21429400 TAAAAAACACAAAATTAGCCAGG - Intergenic
1094019592 12:25900110-25900132 GCAAAAACCTAGATGCAGCCTGG + Intergenic
1094120141 12:26964409-26964431 TAAAGAACACTTATGCAGCTAGG - Intronic
1094230426 12:28096323-28096345 TGCAAATCACAGATGCAGTCCGG - Intergenic
1094558808 12:31530075-31530097 TAAAAAAAATACATGCAGCCGGG + Intronic
1094646028 12:32325132-32325154 AAAAAAACATAAATGGAGCCAGG - Intronic
1095204450 12:39423551-39423573 TAAAAAAAAAAAATGCAGGCTGG + Intronic
1096081381 12:48835275-48835297 TAAAAATCAGAGATTCAGCCAGG + Intronic
1096336775 12:50763103-50763125 TAAAAAATACAAAAGTAGCCGGG - Intergenic
1096397916 12:51280528-51280550 AAAAAAATACAAAAGCAGCCGGG - Intergenic
1096691244 12:53323201-53323223 TAAAAAATACAAAACCAGCCAGG + Intronic
1096736623 12:53660551-53660573 TAAGAAACACAGATTAAGGCTGG + Intronic
1097115034 12:56690836-56690858 TAAAAAACACAAAATTAGCCGGG + Intergenic
1097239641 12:57566397-57566419 AAAAAAACACTGTCGCAGCCAGG - Intronic
1097765666 12:63523784-63523806 TAAAAAACTCAAATCCGGCCGGG - Intergenic
1097869955 12:64593511-64593533 AAAAAAACACAACTTCAGCCAGG - Intergenic
1098196536 12:68008119-68008141 TAAAAATTAGAGATACAGCCAGG + Intergenic
1098264040 12:68700698-68700720 TAAAAAACACAGATGTAAAGAGG - Intronic
1098983310 12:76983779-76983801 TAAAAAACACATTTGGAACCTGG - Intergenic
1099129256 12:78805262-78805284 TAAAATACATAGATGGATCCTGG + Intergenic
1099417400 12:82408415-82408437 AAAAAAACACAGATGCAAGAGGG + Intronic
1099983744 12:89638521-89638543 TAATAAATACAGAAGCAGACAGG + Intronic
1100225598 12:92552740-92552762 TAAAAAACACATAGGCAGGCTGG - Intergenic
1100373991 12:93995307-93995329 TAAAACATACACATGCGGCCAGG + Intergenic
1100526313 12:95423050-95423072 TAAAAAACCTAGAGGCAGCCAGG + Intergenic
1101366961 12:104081742-104081764 TAAAAAATAGAGCTGTAGCCAGG + Intronic
1101644330 12:106614802-106614824 TTAAAAACACACAGGCGGCCAGG - Intronic
1101871538 12:108569911-108569933 TAAAAAACATTCATCCAGCCGGG + Intergenic
1101926985 12:108980451-108980473 TAAAAAATAAAAATACAGCCAGG + Intronic
1101936061 12:109058272-109058294 TAAAAATCAAAGATGGAGGCCGG + Intronic
1101993425 12:109506507-109506529 TAAAAAATACAAAATCAGCCGGG - Intronic
1102361097 12:112288325-112288347 AAAAAAAAAAAGATGCAGCAAGG + Intronic
1102452859 12:113054736-113054758 CAACAAACACAGAGGCAGCATGG + Intergenic
1102511623 12:113419489-113419511 TAAAACACAGACCTGCAGCCAGG - Intronic
1103037041 12:117664985-117665007 TAACAGAAACAGAGGCAGCCTGG - Intronic
1103075350 12:117977971-117977993 TAAAAAGCACACATGCAGCCAGG + Intergenic
1103115090 12:118321546-118321568 TGAAAAACATACTTGCAGCCAGG - Intronic
1103171834 12:118827445-118827467 CCAAAAACACAGATTCAACCTGG - Intergenic
1103372107 12:120427370-120427392 TAAAAAACATGGGTGAAGCCAGG - Intergenic
1103378622 12:120476770-120476792 TAAAAAATACAGAATTAGCCAGG - Intronic
1103393947 12:120593507-120593529 TAAACAACAGAAATTCAGCCAGG - Intergenic
1103594422 12:122015426-122015448 TTAAAAATACAGTTACAGCCAGG + Intergenic
1103619512 12:122178131-122178153 TTAAAACCACAAATGCAGCCAGG - Intronic
1103680873 12:122692595-122692617 TTAAAAACCCAGATCCAGGCCGG - Intergenic
1104281591 12:127382919-127382941 TCAAAAATATAGAGGCAGCCCGG - Intergenic
1104383384 12:128327676-128327698 TATAAAACCAAGCTGCAGCCGGG - Intronic
1104385473 12:128347722-128347744 TGAAAAAGACACATGCAGGCTGG - Intronic
1104394620 12:128421809-128421831 TGAAAAACACATATGCAGATAGG + Intronic
1104545254 12:129705343-129705365 TAAAAAACACAGTTGCATCAAGG + Intronic
1104826914 12:131718050-131718072 CAAAAATCAGAGATGAAGCCGGG - Intronic
1105041155 12:132962463-132962485 TAAAAAACATAAAATCAGCCGGG - Intergenic
1105348888 13:19598738-19598760 TAAAAAACACAAAATTAGCCGGG + Intergenic
1105389684 13:19963132-19963154 TAAAAAAATCACATGCAGGCCGG - Intronic
1105423657 13:20275065-20275087 CAAAAGACACCAATGCAGCCAGG + Intergenic
1106240318 13:27906900-27906922 TAAAAAAAAAAGATTCGGCCGGG - Intergenic
1106324313 13:28673362-28673384 TAAAAATAACAGATTCGGCCGGG - Intronic
1106441432 13:29776556-29776578 TAATAAAGAAAAATGCAGCCAGG - Intronic
1106712792 13:32356201-32356223 AAAAAAACACAAAAGTAGCCAGG - Intronic
1108114036 13:47108565-47108587 TAAAAGACCCAGATGTGGCCGGG - Intergenic
1108200039 13:48034194-48034216 TAAAAAACACACATGCGGCCGGG + Intergenic
1108355803 13:49627899-49627921 AAAAGAACACATGTGCAGCCTGG + Intergenic
1108410904 13:50145861-50145883 TGAAAAAAACAGAAACAGCCGGG - Intronic
1108460210 13:50658367-50658389 TAAAAAAGAAAGATGAAGCAAGG - Intronic
1108869308 13:54963039-54963061 GAAAAAACTCTGATGCAGCCGGG + Intergenic
1108923360 13:55704903-55704925 TAAAAAAAACAAAAGCAGACAGG + Intergenic
1109266484 13:60206491-60206513 TAAAACACACAGATGCACAATGG - Intergenic
1109345895 13:61113974-61113996 TAAAAACCCCAGACCCAGCCAGG + Intergenic
1109442226 13:62390145-62390167 TATAGAACACTGATGCAACCAGG - Intergenic
1110138653 13:72100477-72100499 TAAAAAAAAAAAATCCAGCCTGG - Intergenic
1110996503 13:82116536-82116558 TAAATAACACAAATGCTGTCTGG + Intergenic
1112057599 13:95705145-95705167 TCAAAAACACAGATTAGGCCAGG - Intronic
1112061941 13:95749752-95749774 TAAAACCCACAGTTTCAGCCAGG + Intronic
1112521674 13:100101130-100101152 TAAAAAGCATAGATGCCTCCCGG - Intronic
1112997367 13:105590571-105590593 TTAAAAACTCACTTGCAGCCGGG + Intergenic
1113202099 13:107877122-107877144 TAAAAGACACAGATGGTGGCTGG + Intergenic
1113278954 13:108767395-108767417 AAAAATACCCAGATACAGCCAGG - Intronic
1113544534 13:111138016-111138038 TCAAAAACACAGCTGGGGCCAGG + Intronic
1114007392 14:18329987-18330009 CTAAAAACACATTTGCAGCCAGG - Intergenic
1114293156 14:21305562-21305584 TTAAAACCACAGATCCAGGCCGG + Intronic
1114294767 14:21319264-21319286 TGAAAAACACACACACAGCCTGG + Intronic
1114780705 14:25535474-25535496 TAAAAAACATAAATGCACCGGGG - Intergenic
1115633374 14:35267494-35267516 TAAAAAGCCCCGATGCAGGCCGG + Intronic
1116344327 14:43771746-43771768 TAAAAAAGAAAAAAGCAGCCGGG + Intergenic
1116940162 14:50783423-50783445 TAAGAAACACAGATCCAGCCAGG + Intronic
1117400769 14:55356751-55356773 TCAAAAAAACAGAAACAGCCAGG - Intronic
1117651660 14:57914266-57914288 TAAAAAACCCAGTCTCAGCCGGG + Intronic
1118277926 14:64402599-64402621 AAAAAAGCACAAGTGCAGCCTGG + Intronic
1118663231 14:68037512-68037534 AAAAAAAGAAAGAGGCAGCCAGG - Intronic
1118668373 14:68095678-68095700 TAAAACAAACAGACTCAGCCAGG + Intronic
1119237499 14:73031737-73031759 TAAAAACCTCACTTGCAGCCAGG + Intergenic
1119981051 14:79081451-79081473 TAAAATACAAAAAAGCAGCCAGG + Intronic
1120899739 14:89565445-89565467 GAAAAAACACAGACTCACCCAGG + Intronic
1120957095 14:90092424-90092446 TATGAAACACAGATGCAGTAAGG + Intronic
1121183087 14:91944032-91944054 TTAAAAATACAAAAGCAGCCGGG + Intronic
1121457777 14:94049732-94049754 TAAAAAAAAAAAATTCAGCCAGG + Exonic
1121679797 14:95783977-95783999 TTAAAAGCACAGATCCAGCCAGG - Intergenic
1123391314 15:19876653-19876675 CTAAAAACACATTTGCAGCCAGG - Intergenic
1123478642 15:20611513-20611535 GAAAGAATAAAGATGCAGCCTGG - Intergenic
1123639371 15:22388872-22388894 GAAAGAATAAAGATGCAGCCTGG + Intergenic
1123712734 15:23001336-23001358 TAAAAAAAAAAAAGGCAGCCAGG - Intronic
1123874666 15:24611750-24611772 GACAAACCACAGATGCAGACTGG + Intergenic
1124066733 15:26351641-26351663 TGAAAAAAGCAGATGAAGCCAGG - Intergenic
1124531069 15:30506944-30506966 TAAAAAAGAAAAATTCAGCCGGG + Intergenic
1124767586 15:32500752-32500774 TAAAAAAGAAAAATTCAGCCGGG - Intergenic
1125038842 15:35159783-35159805 GAAAAAACATAGATTCAACCTGG + Intergenic
1125214299 15:37252630-37252652 TAAGAAACAGAAATACAGCCTGG - Intergenic
1125543784 15:40488096-40488118 CCAAAAACAAATATGCAGCCCGG + Intergenic
1125574620 15:40746819-40746841 TAAAAAACAAAGGTGCAGTTAGG - Intronic
1125645285 15:41267364-41267386 TAAAAAAAAAAGAAGCAGCCGGG + Intronic
1125706828 15:41745174-41745196 TTAAAAACACATTTACAGCCAGG - Intronic
1125961340 15:43832417-43832439 AAAAAAACAAAGATGAACCCAGG - Intronic
1126079933 15:44949953-44949975 TAAAAAATATTGCTGCAGCCTGG + Intergenic
1126672448 15:51128419-51128441 TAAAAAACAAAAGTGCACCCAGG - Intergenic
1126806262 15:52352311-52352333 TGGGAAACACAGATGCAGACAGG + Intronic
1127609392 15:60622314-60622336 TAAAATACCAAGATGCAGGCTGG + Intronic
1127808437 15:62542350-62542372 TAAAAAATACAAAATCAGCCAGG - Intronic
1128154167 15:65382341-65382363 TAATAAACACAGATGCTTTCAGG + Exonic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128406200 15:67341962-67341984 TTAAAAACAAAGATGCAGAGTGG + Intronic
1128485323 15:68080125-68080147 TAAAAATAACAAATCCAGCCAGG - Intronic
1128533105 15:68468645-68468667 AAAAAAAGAAAGATGCCGCCAGG + Intergenic
1128632364 15:69279844-69279866 TAAAAGTCACCGATGCAGGCGGG + Intergenic
1128652641 15:69430175-69430197 TAAAAAACACATATACAGATTGG - Intronic
1128787626 15:70409964-70409986 TAAATAACACTGATGAGGCCAGG - Intergenic
1129015686 15:72466645-72466667 TTAAAAATGCATATGCAGCCGGG + Intergenic
1129094867 15:73195400-73195422 AAAAACACACAGACGCAGCATGG - Intronic
1129100184 15:73254567-73254589 GAAAAAACATAGAGGCAGCAAGG - Intronic
1129570344 15:76676118-76676140 TAAGAAACCCAGTTTCAGCCGGG - Intronic
1130954167 15:88615157-88615179 GAAAAAACACAGACGAGGCCGGG - Intergenic
1131040481 15:89260967-89260989 TAAAAAACAAAGAAGCAGGCCGG + Intronic
1131101431 15:89692901-89692923 TATAAAAAACAGATGAGGCCAGG - Intronic
1131163963 15:90128923-90128945 TAAAAAACACAGTTTCGGCAGGG + Intergenic
1131170974 15:90177860-90177882 AAAAAAACACAACTGAAGCCTGG + Intronic
1131457425 15:92593404-92593426 GAAAGCACACAGAAGCAGCCAGG - Intergenic
1131496348 15:92914535-92914557 TAAAATTCACAGCTGAAGCCAGG - Intronic
1131500588 15:92961017-92961039 TAAAAAACACAAATGCGGCCAGG - Intronic
1132114587 15:99126196-99126218 TTGAAACCACAGATGCAGTCTGG + Intronic
1132130515 15:99273530-99273552 TAAAACACACAGACACGGCCGGG - Intronic
1132347952 15:101119853-101119875 AAAAAAACACAAATGAGGCCGGG - Intergenic
1132475655 16:136391-136413 AAAAAAACACAAGTGCAGGCTGG + Intronic
1132982722 16:2746940-2746962 AAAAAAAAAAAAATGCAGCCTGG - Intergenic
1133393113 16:5425398-5425420 TAGAAAACACACATGCTGGCCGG - Intergenic
1133722622 16:8508998-8509020 CAAAAAACACAGATGCCGGTGGG + Intergenic
1133861234 16:9597395-9597417 TAAAAAAAATAGAGACAGCCGGG + Intergenic
1134017871 16:10901894-10901916 TGATCAACACAGCTGCAGCCAGG + Intronic
1134197937 16:12173442-12173464 TACAAAAAACAGATGCTGGCTGG + Intronic
1134656562 16:15951983-15952005 TGAAAAACACAAAAACAGCCGGG - Intronic
1135263707 16:21003189-21003211 TAAAAATCATAGATGCTTCCTGG + Exonic
1135288047 16:21210868-21210890 AAAAAAAAAAAAATGCAGCCAGG - Intronic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1135696766 16:24594661-24594683 TCAAAATCACAGTTGCGGCCAGG - Intergenic
1135938468 16:26800686-26800708 TAAAAAACACAGAGTAAGGCTGG - Intergenic
1136042189 16:27588617-27588639 TAAAAAACATGGATGGAGCCAGG - Intronic
1136084245 16:27873332-27873354 TGTAAAACACATATGCAGGCTGG - Intronic
1136161932 16:28425786-28425808 TAAAAAACACCCATGGGGCCGGG + Intergenic
1136201033 16:28689202-28689224 TAAAAAACACCCATGGGGCCGGG - Intronic
1136217375 16:28803388-28803410 TAAAAAACACCCATGGGGCCGGG - Intergenic
1136465435 16:30440009-30440031 TAAAAAACAATAAAGCAGCCAGG - Intergenic
1136473977 16:30500512-30500534 TTAAAAACCTAGAAGCAGCCAGG - Intronic
1136641139 16:31566295-31566317 AGAAAAACACAGAGGCTGCCTGG + Intergenic
1137258372 16:46798231-46798253 TACAAAAGAGAAATGCAGCCGGG + Intronic
1137485611 16:48888148-48888170 TAGACAACACAGGTGCTGCCAGG + Intergenic
1138602641 16:58065758-58065780 TAAAAAAAAAAAATCCAGCCGGG - Intergenic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1138820247 16:60250590-60250612 TAAAAAACTGATATGCGGCCAGG - Intergenic
1139667137 16:68465263-68465285 TAAAAAGCAGAGAAGCAGCCAGG - Intergenic
1139716883 16:68820752-68820774 TTAAATACACAGAAGCAGTCTGG - Intronic
1139771891 16:69284410-69284432 TAAGACACACAAATGCAGCCTGG + Intronic
1139823734 16:69740755-69740777 TTAAAAGCACAGATGGAGGCCGG + Intergenic
1140166719 16:72560000-72560022 TAAAAATCAAATATGCGGCCGGG + Intergenic
1140619355 16:76709494-76709516 TGAAAATGACAGATCCAGCCAGG + Intergenic
1140775878 16:78248573-78248595 TAAAATACAAAAATGTAGCCAGG + Intronic
1141494519 16:84398105-84398127 TAAAAAAAACACATGTGGCCGGG + Intronic
1141981600 16:87553681-87553703 AAAAAAATAAAGAAGCAGCCAGG - Intergenic
1142036311 16:87864129-87864151 TAAAAAATACAAAATCAGCCAGG + Intronic
1142168462 16:88606615-88606637 CAAAAAACACATCAGCAGCCAGG - Intronic
1142357541 16:89609381-89609403 TTTAAAACAGAGATGCAGCCGGG + Intergenic
1142477219 17:195752-195774 TAAAAATATCAAATGCAGCCTGG - Intergenic
1142541035 17:659574-659596 TAAAGACCCCTGATGCAGCCGGG - Intronic
1142571446 17:877439-877461 TGAAAAACACAGTCGCGGCCGGG - Intronic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1143078243 17:4363967-4363989 AAAAAAAAAAAGATGCAGACGGG + Intronic
1143139600 17:4733912-4733934 TAAAAAACACACATAGGGCCAGG + Exonic
1143333925 17:6158444-6158466 TAAAAAATACAAAAGTAGCCGGG + Intergenic
1143947858 17:10609831-10609853 TAAAAAATACTGATGCTGGCCGG - Intergenic
1144284285 17:13757858-13757880 TACAAAATACTGATGCCGCCAGG - Intergenic
1144477934 17:15604830-15604852 TTAAAAACACATATGTGGCCAGG - Intronic
1144567172 17:16369194-16369216 TAAAAAAGAAAGATGTAGCCTGG - Intergenic
1144622343 17:16825460-16825482 TAAAAAGCAGAGAGGCGGCCGGG + Intergenic
1144746500 17:17618938-17618960 TAAAAAACCAAGACCCAGCCAGG + Intergenic
1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG + Intronic
1145129874 17:20334836-20334858 TTAAAAACAAGCATGCAGCCGGG + Intergenic
1145952518 17:28830320-28830342 TAAAAAACAAAGAATTAGCCAGG - Intronic
1146227204 17:31077508-31077530 TAAAAAATACAGAAGTAGCTGGG + Intergenic
1146272690 17:31494771-31494793 TTAAAAACACAGAAGCTGGCTGG - Intronic
1146331341 17:31930115-31930137 TAAAAAATACAAATTTAGCCAGG + Intergenic
1146657377 17:34642695-34642717 TAAAAAACAAAAATGTAGCTGGG - Intergenic
1147190739 17:38736537-38736559 TAAAAAACACCAATGTGGCCGGG + Intronic
1147351461 17:39849361-39849383 TAAAAAAAAAAAATCCAGCCAGG + Intronic
1147576687 17:41605384-41605406 TAAAAAGCAGAGAGGCGGCCGGG + Intergenic
1148043661 17:44728521-44728543 TAAAAAAGGTAGATGCAGCCAGG + Intronic
1148446097 17:47738366-47738388 CAAAAAGCAAAGCTGCAGCCTGG - Intronic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1148636399 17:49152376-49152398 TCAAAAACAAAAATGCAGCCAGG + Intronic
1148848953 17:50545192-50545214 TGAAAGACACAGATGGAGGCAGG - Intronic
1148962924 17:51408498-51408520 TAAAAAACACAAAATTAGCCAGG - Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149353189 17:55812742-55812764 TAAATGACACAGATTTAGCCTGG - Intronic
1149719063 17:58824902-58824924 TAAAACACAAAGAAGCAGGCTGG - Intronic
1149898442 17:60450137-60450159 AAGAAAACACTGATGCAGGCTGG + Intronic
1149952878 17:61009977-61009999 TATAAAACACAGATGCTACAAGG - Intronic
1149976248 17:61269273-61269295 TAAAAAACACAAAATTAGCCAGG - Intronic
1150152563 17:62822415-62822437 TGAAAAACAAAGTTGCGGCCAGG + Intergenic
1150241073 17:63633065-63633087 TAAAAAACACAAAATTAGCCAGG + Intronic
1150323116 17:64233276-64233298 TTAAAAACACACATGCGGCCTGG + Intronic
1150542125 17:66112646-66112668 TAAATAACACAGTGCCAGCCAGG + Intronic
1150555259 17:66248612-66248634 TGGAAAATACAGATACAGCCTGG + Intronic
1151007358 17:70453195-70453217 TAAAATACACAGAATTAGCCGGG - Intergenic
1151143964 17:72021641-72021663 TAAAAAAAACAGATGCTTGCAGG + Intergenic
1151191108 17:72398799-72398821 AAAAAAAAAAAGATGCATCCTGG + Intergenic
1151275169 17:73028820-73028842 AAAAAAACACTGCTGCAGCCGGG + Intronic
1151551985 17:74827589-74827611 TTAAAAATGCAGATGCGGCCGGG - Intronic
1151668094 17:75557175-75557197 TAAAAAACAAAACTGCAGGCTGG - Intronic
1152063205 17:78094733-78094755 AAAGAACCACAGAAGCAGCCAGG - Intronic
1154202892 18:12311300-12311322 TAAAAAACAAAAATCAAGCCAGG + Intronic
1154262596 18:12850326-12850348 TAAAAAACACAAAATTAGCCAGG + Intronic
1154372662 18:13778840-13778862 TAAAAAACACACAGGTGGCCAGG + Intergenic
1154530080 18:15333954-15333976 CTAAAAACACATTTGCAGCCAGG + Intergenic
1154998650 18:21665519-21665541 TAAAAAACAAACAAGCAGCCAGG + Intronic
1155048267 18:22123628-22123650 TTAAAACCACAGCAGCAGCCGGG + Intergenic
1155185189 18:23381499-23381521 TAGAAAATACAGATGGAGGCCGG - Intronic
1155626787 18:27844174-27844196 TAACAACCACAGATGTAGACAGG + Intergenic
1155965565 18:32032371-32032393 TAAAAAAAAAAAATACAGCCAGG - Intronic
1155993924 18:32310006-32310028 TAATAAATACAGAAGCAGTCAGG + Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1156309226 18:35907515-35907537 TAAAGAACACAGAGGCAGCTAGG + Intergenic
1157371159 18:47113391-47113413 TAAATAATACAGCTGCAGACAGG + Intronic
1157486844 18:48093726-48093748 TTAAAAACCAAGATGCTGCCTGG - Intronic
1158199893 18:54928434-54928456 TAATAAACACAGAAGCATCAGGG + Intronic
1158484084 18:57849203-57849225 TAAAAAACAACAAGGCAGCCAGG + Intergenic
1158995922 18:62919409-62919431 GAAAAAACAGACATACAGCCAGG + Intronic
1159872011 18:73768926-73768948 TAATAAATACAAATGCAGCATGG - Intergenic
1160166148 18:76514265-76514287 TTAAAAGCAGGGATGCAGCCAGG + Intergenic
1160684782 19:428657-428679 CAAAGAAAACAGATGCAGACAGG + Intronic
1160903950 19:1443570-1443592 TAAAAAAAACAAATGGAGCCGGG + Intergenic
1161117701 19:2507951-2507973 TGAAAAACCCACATGCGGCCGGG - Intergenic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161757651 19:6146172-6146194 TCAAAAAATCAGATGGAGCCAGG + Intronic
1161773047 19:6241712-6241734 TAGGAAACACAGATGCATCTGGG + Intronic
1161996091 19:7712451-7712473 TAAAAAAAAAAGTTACAGCCAGG - Intergenic
1162375318 19:10301648-10301670 TAAAAAACAAAAAATCAGCCAGG - Intergenic
1162414212 19:10524654-10524676 TAAAAAATACAAAATCAGCCAGG + Intergenic
1162609917 19:11741264-11741286 TAAAAAACTCAGAAATAGCCGGG - Intergenic
1163265699 19:16219693-16219715 TATAAAACATAAATGAAGCCAGG - Intronic
1163591485 19:18196509-18196531 AAAGAAACACAGAGGCTGCCTGG - Exonic
1163656487 19:18548739-18548761 TAAAAAACAAAGATGGACCCGGG - Intergenic
1163958792 19:20667763-20667785 TAAAAAAAACCGATGCAGCTGGG - Intronic
1165197384 19:34115447-34115469 TAAAAGACAAAGATTCGGCCAGG + Intergenic
1165530489 19:36396199-36396221 AAAAAAACAAAAATACAGCCAGG - Intronic
1165798646 19:38534304-38534326 TAAAAATCACAGATGTGGCTGGG - Intronic
1165807772 19:38591974-38591996 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1165986927 19:39777662-39777684 TAAAAGACATAGATGGGGCCAGG + Intronic
1166132889 19:40757186-40757208 TAACAATCACAGAAGCAGCCAGG - Intronic
1166904599 19:46098777-46098799 TAAAAGACACAGATTGGGCCTGG - Intergenic
1167082763 19:47288544-47288566 TATAAAAAACACATGCAGCCAGG + Intergenic
1167162121 19:47774909-47774931 AAAAAAATAGAGATGGAGCCAGG - Intergenic
1168210161 19:54884334-54884356 CAAAAACCCCAGTTGCAGCCAGG + Intronic
1168426385 19:56242499-56242521 TACAGAACACAGAGACAGCCAGG - Intronic
1168509733 19:56964902-56964924 TAAAATACACATAAGCAGGCCGG + Intergenic
1168648616 19:58078141-58078163 TTAAAAACACAGATTCGGCCGGG - Intronic
926069000 2:9869517-9869539 TAAAAAACAAATAAGCAGGCCGG - Intronic
926191404 2:10730811-10730833 TAAAAAACACAGAATTAGCCAGG - Intronic
926554564 2:14341871-14341893 TAAAAACCACAGACTTAGCCAGG + Intergenic
926808634 2:16736467-16736489 TAAAAAACACCAATGAAGCGGGG + Intergenic
927516678 2:23675593-23675615 CACCAAACACAGGTGCAGCCTGG - Intronic
928402067 2:30986209-30986231 GAAAACACACAGACCCAGCCAGG + Intronic
929144643 2:38695993-38696015 TAAAAAACAAACACGCAGGCGGG - Intronic
929622072 2:43365218-43365240 TTAAAAACACAGATGAGGCCAGG - Intronic
929700016 2:44153957-44153979 AAATAAACACTGAAGCAGCCGGG + Intergenic
929931849 2:46263416-46263438 AAACATACACAGATGCGGCCTGG + Intergenic
930129408 2:47833961-47833983 TTGAAAATAAAGATGCAGCCAGG - Intronic
930217697 2:48713783-48713805 TTTCAAAGACAGATGCAGCCTGG - Intronic
930749153 2:54915687-54915709 TACAAGATAAAGATGCAGCCAGG - Intronic
930759367 2:55016285-55016307 AAAAATACACATATGCGGCCAGG + Intronic
931067035 2:58598787-58598809 TAAAAAATACAAAATCAGCCAGG - Intergenic
931354040 2:61518255-61518277 TAAAAAACAAAGAAAAAGCCAGG + Intronic
931538532 2:63303978-63304000 AAAAAAAAACAGATGTAGGCAGG + Intronic
931744994 2:65284088-65284110 TAAAAAATATTGAAGCAGCCAGG + Intergenic
933337860 2:80983276-80983298 AAAAAGACACAGATGGAACCTGG + Intergenic
933443031 2:82338500-82338522 TAAAAAAAAATGAGGCAGCCGGG + Intergenic
935961005 2:108425434-108425456 TAAAAAACACAAAATTAGCCGGG + Intergenic
936085337 2:109463732-109463754 TAAAACAAACATTTGCAGCCAGG - Intronic
936371669 2:111907117-111907139 TAAAAATGAGTGATGCAGCCAGG + Intronic
936717170 2:115201165-115201187 TTAAAAACACAGAACCGGCCGGG + Intronic
936929267 2:117770297-117770319 TATAATACACAGATGCAGGCAGG + Intergenic
937957656 2:127430758-127430780 TTAAAAACACTGATGTGGCCGGG + Intergenic
938529176 2:132165396-132165418 CTAAAAACACATTTGCAGCCAGG + Intronic
938770804 2:134499190-134499212 TAAATAAAAAAGATGCAGTCGGG + Intronic
938870613 2:135472203-135472225 TAAAACTCACAGATGTGGCCGGG + Intronic
938918954 2:135975047-135975069 TAAAAAACAATGATGCGGCCGGG + Intronic
939575199 2:143887145-143887167 TAAATAACACAGATAAAGACAGG - Intergenic
939612274 2:144326290-144326312 TAAAATACACAGACTCAGCCAGG + Intronic
939616090 2:144363609-144363631 TACAAAATACAGATGCGGCCGGG - Intergenic
940413080 2:153388899-153388921 AAAAAAACTGAGATGGAGCCTGG + Intergenic
940785316 2:157974761-157974783 TAAAAATAAGAGATTCAGCCAGG - Intronic
940975528 2:159939210-159939232 TTAAAAATACAGATGAGGCCAGG + Exonic
941450521 2:165654920-165654942 TTAAAAACACAGATGATTCCGGG - Intronic
941724331 2:168844878-168844900 AAAAAAAAAAAGATTCAGCCTGG + Intronic
942051020 2:172141090-172141112 TAAAAAATATATTTGCAGCCAGG + Intergenic
942246884 2:174016234-174016256 TAGAAAACACTGATGATGCCTGG + Intergenic
942473452 2:176287839-176287861 TAAAAAACACATTTGCAAGCAGG - Intronic
943026531 2:182636251-182636273 TAAAAAATACAGGTGAGGCCGGG - Intergenic
945000566 2:205345873-205345895 TAAAAAAAGAAGATGCAGCTGGG + Intronic
945005388 2:205399648-205399670 TAAAAAAAGAAGATGCAGCTGGG - Intronic
945457708 2:210068169-210068191 TAAATAAAAAATATGCAGCCGGG - Intronic
945457968 2:210070862-210070884 TAAATAAAACATATGTAGCCGGG + Intronic
945478898 2:210321463-210321485 TAAAAAAAAATGATCCAGCCAGG + Intergenic
945612346 2:212019600-212019622 TAAAATACAAAAATTCAGCCAGG + Intronic
945748054 2:213743196-213743218 TAAAAAACAACAATACAGCCGGG - Intronic
946111800 2:217426316-217426338 TAAATAGCACTGAAGCAGCCTGG + Intronic
946266499 2:218547174-218547196 TAAAAAATACAAATGGAGCCAGG + Intronic
946540883 2:220683386-220683408 TAAGAAACACAATTCCAGCCAGG - Intergenic
946668102 2:222072547-222072569 TAAAAAACACCTATGCTGGCCGG + Intergenic
947363543 2:229370674-229370696 TAAAAAATTCAGTTGCAGGCAGG + Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948528693 2:238589352-238589374 TAAACAGCACATATGCAGACTGG - Intergenic
948947961 2:241230891-241230913 AAAAGAACACAGAAGCTGCCAGG - Exonic
1168939712 20:1698272-1698294 TTAAAAACACAAAAGTAGCCAGG - Intergenic
1169322900 20:4649298-4649320 TAAGAAACACATTCGCAGCCGGG - Intergenic
1169367537 20:5003086-5003108 TAAAAAACAAAGATGCGGCCGGG + Intronic
1169375893 20:5066371-5066393 TAAAAAACAAAAATGTTGCCTGG + Intergenic
1169422677 20:5472477-5472499 TAAAATACAAAGAAGTAGCCAGG - Intergenic
1169426743 20:5502998-5503020 TAAAATACAAAGAAGTAGCCAGG + Intergenic
1170839994 20:19916903-19916925 TCAAATGCACAGATGGAGCCAGG - Intronic
1170860570 20:20099470-20099492 TACAGAAGACAGATGCAGACAGG + Intronic
1170905426 20:20511893-20511915 TAAAACACACACACTCAGCCAGG + Intronic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1171324133 20:24276088-24276110 TGAGAGACACAGAAGCAGCCTGG - Intergenic
1173283616 20:41651029-41651051 TAAAACATCCAGATCCAGCCTGG - Intergenic
1173452160 20:43174498-43174520 TGAAAATCACAGGTGCAGCAGGG - Intronic
1174124795 20:48296400-48296422 TGAAAAACACAGAGCCAGCCCGG + Intergenic
1174316149 20:49703591-49703613 TAAAACATACAGATTCAGCCGGG + Intronic
1174530692 20:51211194-51211216 TAAAATACACAAAAGTAGCCAGG - Intergenic
1174628542 20:51936201-51936223 TAAAAAACAAAAGTGCGGCCAGG + Intergenic
1174718180 20:52782973-52782995 AAGAAAACACAGAAGCAGCAGGG - Intergenic
1174849203 20:53975651-53975673 ATTAAAACACAGATGCAGCCAGG + Intronic
1175285865 20:57836386-57836408 TGGAGAACAAAGATGCAGCCAGG - Intergenic
1175517526 20:59578466-59578488 TTAAAAACACAGATTCTCCCAGG - Intronic
1176387267 21:6144794-6144816 TAGACAGCACGGATGCAGCCGGG - Intergenic
1176767331 21:13034520-13034542 CTAAAAACACATTTGCAGCCAGG - Intergenic
1176897592 21:14400419-14400441 CGAAAATCACAGATGTAGCCAGG - Intergenic
1177813542 21:25950632-25950654 CAAAAAAAACAGCTGCAGGCCGG - Intronic
1178609747 21:34070733-34070755 TAACAAGCACAGAAGCGGCCGGG - Intergenic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1178713073 21:34937266-34937288 TTAAAAACACAGATGGACCTGGG + Intronic
1178924576 21:36764101-36764123 CAAAAAACAAACATGCAGCTGGG + Intronic
1178986405 21:37307423-37307445 TAAAAAAGACAGAGGAAGCTAGG + Intergenic
1179356491 21:40665181-40665203 AAGAAAACACAGAGGCAGGCTGG + Intronic
1179736206 21:43393454-43393476 TAGACAGCACGGATGCAGCCGGG + Intergenic
1179774743 21:43654079-43654101 TAACAAACACAGATAAAGTCAGG + Intronic
1180018758 21:45105396-45105418 TAAAATACAAAGAAGCAGGCCGG - Intronic
1180056300 21:45360831-45360853 AAAACAACACAGATCCGGCCGGG - Intergenic
1180431899 22:15260795-15260817 CTAAAAACACATTTGCAGCCAGG - Intergenic
1181021129 22:20103609-20103631 CCAAGAACACAGATGCAGCAGGG - Intronic
1181025861 22:20127332-20127354 TAAAAAACACATTTGGAACCTGG + Intronic
1181144558 22:20835424-20835446 TTAAAAACATGGCTGCAGCCAGG + Intronic
1182386392 22:29945542-29945564 TAAAAAAAAAAAATGTAGCCAGG + Intronic
1182879233 22:33719082-33719104 TTGAAAACAAAGATACAGCCGGG - Intronic
1183461131 22:37951346-37951368 TAAAAAAAACAAAGACAGCCGGG - Intronic
1183550316 22:38478937-38478959 ATCAAAACACAGATGCTGCCTGG - Intronic
1183983592 22:41557051-41557073 TAAAACACAGAGGTTCAGCCAGG - Intergenic
1184110992 22:42394962-42394984 TAAAAAACTCAAAACCAGCCTGG + Intronic
1184230085 22:43153951-43153973 TAAAAAATAAAGAAACAGCCTGG - Intronic
1184530875 22:45054865-45054887 AAAAAAAAACAGAGGAAGCCGGG + Intergenic
1185075769 22:48681345-48681367 TAAAAACCAGAGATGAGGCCGGG + Intronic
1185114373 22:48923179-48923201 TAAAAAAGCCAGATGTGGCCAGG - Intergenic
1185118463 22:48951519-48951541 AAAAAAAAACAAATGTAGCCAGG + Intergenic
950331553 3:12159744-12159766 TAGAAAACAAAGAAGCAGGCTGG + Intronic
950455737 3:13091772-13091794 TAAAAAACAAAGACACAGGCAGG + Intergenic
950640020 3:14342683-14342705 TACAAAACACACATTCAGCTGGG + Intergenic
950718970 3:14868997-14869019 TAAAAAACAAACTGGCAGCCAGG + Intronic
951075378 3:18385325-18385347 AAGAAAACACATTTGCAGCCGGG + Intronic
951606724 3:24442661-24442683 TAAAAAATACAAAAGTAGCCAGG + Intronic
951716133 3:25648559-25648581 TAAAAAACTAAATTGCAGCCAGG + Intronic
952029456 3:29123629-29123651 TATAAAACATATATTCAGCCAGG - Intergenic
952954010 3:38545419-38545441 TTATAAACACAGACTCAGCCAGG - Intergenic
954046088 3:47931788-47931810 TTAAAAATACAGATGGAGCCAGG - Intronic
954226291 3:49183385-49183407 TAAAAACTAAACATGCAGCCGGG + Intronic
954236730 3:49262733-49262755 CAAAAAAGATAGTTGCAGCCTGG + Intergenic
954719230 3:52546034-52546056 TAGGAAACATAGATCCAGCCAGG - Intronic
955033932 3:55248217-55248239 TTAAAAACTGAGATGTAGCCAGG + Intergenic
955191634 3:56767285-56767307 TAAAAAATGCACATGCGGCCGGG + Intronic
955331075 3:58047857-58047879 TAAAAAACACGCATGTGGCCAGG - Intronic
955409281 3:58645424-58645446 TAAAAAACTCAGAGGCTGCAGGG - Intronic
955667035 3:61360822-61360844 TAAAAATAAAAGATGCTGCCTGG - Intergenic
955717304 3:61844122-61844144 TAAAAAATACAAATATAGCCGGG - Intronic
955734347 3:62020968-62020990 TAAAAAACATAGATGAGGCCAGG - Intronic
955997909 3:64696579-64696601 AAAAAAAAAAAGAAGCAGCCAGG + Intergenic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956642311 3:71426765-71426787 TTAAAACATCAGATGCAGCCAGG + Intronic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
958253660 3:91299686-91299708 TAAAAAACAAAGAGCCAGACAGG + Intergenic
959341759 3:105140028-105140050 GAAAAAAGACATTTGCAGCCGGG - Intergenic
959450153 3:106488622-106488644 AAAAAAAAACAGATGCAAACGGG - Intergenic
960436702 3:117635020-117635042 TAAAAATCATAGATGAGGCCAGG - Intergenic
960806436 3:121587866-121587888 AAAAAAACCCAAATTCAGCCTGG - Intergenic
960831534 3:121854509-121854531 TAAAAAAGACAGATGAAGATAGG - Intronic
962570899 3:136712793-136712815 TAAAAAACACATATGAGGCCGGG + Intronic
962739527 3:138352877-138352899 GAGAAGTCACAGATGCAGCCTGG - Intronic
962869368 3:139474882-139474904 TAAAAATCACAGGTGCAACAGGG + Intronic
963194014 3:142506396-142506418 TAAAAATAACAGAAGAAGCCAGG + Intronic
963868053 3:150384372-150384394 TAAAAAAAAAAAAAGCAGCCTGG + Intergenic
964096178 3:152934406-152934428 TTAAAAACAGAGAAACAGCCGGG + Intergenic
964103755 3:153018152-153018174 TAAAAAACAAAAATGGGGCCGGG + Intergenic
964619054 3:158702332-158702354 TAAAAAGCAGAAATGCAGGCTGG - Intronic
964762111 3:160144378-160144400 TAAAACTCACAGATTCATCCTGG + Intergenic
964877060 3:161379192-161379214 TAGAAAACACAATTGCAGGCTGG - Intergenic
965260086 3:166471180-166471202 ACAAAAATACAAATGCAGCCAGG - Intergenic
965350432 3:167605487-167605509 GAAAAAAAACAGATGCAGTCTGG + Intronic
965588728 3:170342684-170342706 TAAAAGGCAAGGATGCAGCCAGG - Intergenic
965605549 3:170494731-170494753 TAAACAATGCATATGCAGCCTGG + Intronic
965798798 3:172469547-172469569 TAAAAACCTCTGATGCAGCCAGG + Intergenic
966172785 3:177101014-177101036 TAAAAAATACAGAATTAGCCAGG - Intronic
966221424 3:177555292-177555314 TGAAAAACACAGATGGGGGCTGG + Intergenic
966430231 3:179824543-179824565 TAAAAAATACAGAATTAGCCAGG + Intronic
967014178 3:185466670-185466692 TAAAAAACAAACAAACAGCCGGG - Intronic
967056849 3:185836672-185836694 TAGAAAAAACAGAAGCGGCCTGG - Intergenic
967092307 3:186145480-186145502 TGAAAAACACAGTTGTAGACAGG - Intronic
967232157 3:187350153-187350175 TAAAATACGCAGGTCCAGCCTGG + Intergenic
967485181 3:190022344-190022366 TCAAGAAAACAGATCCAGCCAGG + Intronic
967949162 3:194827317-194827339 TTAAAAAGACAGATGCAGCCGGG - Intergenic
968410228 4:384143-384165 AAAAACACACAGTTCCAGCCTGG + Intronic
969145873 4:5123641-5123663 ATAAGAACACAGATGCACCCAGG - Intronic
969183209 4:5457509-5457531 TAAAAAACCCACATGCAGGCTGG - Intronic
969598570 4:8162387-8162409 AAAAAAACAAAAAGGCAGCCAGG + Intergenic
970294519 4:14614287-14614309 CAAAAAACAGAGTTGCAGGCTGG + Intergenic
971228103 4:24773842-24773864 TAAAAAATACAGATACAGCTGGG + Intergenic
971415311 4:26421462-26421484 TAAAAAATACAAAATCAGCCGGG - Intronic
972365886 4:38373982-38374004 TAAAAAATACAAAGGGAGCCAGG - Intergenic
972446717 4:39151244-39151266 TCAAAAAGACAGATGAATCCAGG + Intergenic
972524101 4:39891349-39891371 TAAAAAATACATATTCAGGCCGG + Intronic
972601747 4:40579125-40579147 AAAAAAAAAAAAATGCAGCCAGG + Intronic
972689809 4:41385744-41385766 TAAATAACACAGAGTCACCCAGG - Intronic
973102364 4:46289047-46289069 AAAAAAAAACAGATGCTGGCAGG + Intronic
973588431 4:52415235-52415257 TAACAAACACAGTCTCAGCCAGG + Intergenic
973623208 4:52747740-52747762 AAAGAAACTGAGATGCAGCCGGG + Intronic
975298014 4:72756413-72756435 TAAAAAACCCAGAAGAGGCCGGG + Intergenic
975321342 4:73012224-73012246 TAAAAACCCCAGACTCAGCCAGG + Intergenic
975338965 4:73215551-73215573 TAAAAATCACATTTTCAGCCAGG - Intronic
975583603 4:75928946-75928968 AAAAAAACACAAATTTAGCCGGG - Intronic
975989835 4:80247273-80247295 ACCAACACACAGATGCAGCCTGG + Intergenic
977230113 4:94441518-94441540 TAAAAAACCCAGAGGTGGCCAGG - Intergenic
978074642 4:104513447-104513469 TAGAAAACTCAGATGGATCCTGG + Intergenic
978128657 4:105166818-105166840 TAAAAAAGACAGAATCAGACTGG - Intronic
979355186 4:119695237-119695259 TAAACCTCACACATGCAGCCTGG + Intergenic
979653806 4:123167640-123167662 TAAGAAACACAGCTGTGGCCGGG - Intronic
979768026 4:124486480-124486502 AAGAAAACACAAATGCAGTCTGG + Intergenic
980329557 4:131392270-131392292 TAAAAAAAAAAGCTACAGCCTGG + Intergenic
981723410 4:147824021-147824043 AAAAAAACACAGATTCAGGCTGG + Intronic
981728235 4:147870354-147870376 TAAAATACATATATGCGGCCGGG - Intronic
981953851 4:150446214-150446236 TAAAGAACACAGAGAGAGCCAGG + Intronic
982116484 4:152102725-152102747 TCCATAACAGAGATGCAGCCAGG + Intergenic
982216404 4:153086159-153086181 TTACAAAAACAGAGGCAGCCAGG - Intergenic
982422833 4:155217839-155217861 TAAAAAACACAGGCACAGTCAGG - Intergenic
982457795 4:155630979-155631001 AAAAAAAAAAAGATGCTGCCTGG - Intergenic
982510393 4:156275290-156275312 TAAAAGACACTGATGGGGCCAGG - Intergenic
982523875 4:156453305-156453327 TAAAAAACAAACATGCGGGCTGG - Intergenic
982640900 4:157959311-157959333 AAAAAAACACTGAGTCAGCCAGG + Intergenic
983329947 4:166313029-166313051 TAATAAAAACACATGCAGGCTGG - Intergenic
983583478 4:169331709-169331731 TTAAAAAATCAGATGCAGCCAGG - Intergenic
983900711 4:173130995-173131017 TTAAAAACACACACACAGCCGGG + Intergenic
984648497 4:182244246-182244268 TAGAAAACACAAATGAGGCCGGG - Intronic
984927014 4:184815823-184815845 TAAAAAGCAGAGATGAGGCCAGG + Intronic
987127730 5:14830678-14830700 TACAAAATAGAGCTGCAGCCTGG - Intronic
987442958 5:17979811-17979833 TAGAAATCACAGATGTAGTCAGG - Intergenic
987566780 5:19599605-19599627 AAAAAAACACAGAGCCGGCCAGG + Intronic
987614806 5:20259795-20259817 TAAATGCCACAGATGCTGCCTGG + Intronic
988151379 5:27386228-27386250 TAGAAAAGAAAGATACAGCCTGG - Intergenic
988746302 5:34142134-34142156 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
988822144 5:34897617-34897639 TAAAAAACTGATTTGCAGCCAGG - Intronic
988957680 5:36335221-36335243 TAAAAAACTAAGATGAAGGCTGG - Intergenic
989798607 5:45506574-45506596 TGAAAAACACAAATGCAAACTGG + Intronic
990505631 5:56441467-56441489 TGAAGAAAACAGATGCAGGCAGG - Intergenic
991338591 5:65579210-65579232 TAAAAAACAGAAATGAGGCCAGG - Intronic
991914339 5:71591011-71591033 TAAAAAACAAGGAAGCAGCATGG - Intronic
992845289 5:80740653-80740675 TTAACAACACACATGCGGCCAGG - Intronic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
992963853 5:81982303-81982325 TAAAATACAAAAATTCAGCCTGG + Intronic
992992746 5:82301084-82301106 TAAAAAACACAAAATTAGCCGGG + Intronic
993008049 5:82449329-82449351 TGAAAAACATAGTTTCAGCCAGG - Intergenic
993629780 5:90271998-90272020 TAAAAAAAAAAAATGAAGCCTGG + Intergenic
993843177 5:92906370-92906392 TAGGAAACACTAATGCAGCCAGG - Intergenic
993924390 5:93848087-93848109 TAAAAAAGAGAGATGGTGCCAGG + Intronic
994191703 5:96876058-96876080 TAAAGATCACAGAAGCTGCCCGG + Exonic
994533041 5:100990976-100990998 TAAAAAACACAAAAATAGCCTGG - Intergenic
994698093 5:103098174-103098196 TAAAAAAGCAAGATTCAGCCAGG - Intronic
994781088 5:104090940-104090962 TTAAAAACACAAATACAGCTAGG + Intergenic
994862092 5:105209834-105209856 AAAAAAACACAGCTGAAGCATGG - Intergenic
994866521 5:105279516-105279538 TAAAAAACAAAAATTTAGCCGGG - Intergenic
995252533 5:110010045-110010067 TAAAAAACACAAATGCAAACTGG - Intergenic
995580784 5:113599809-113599831 TAGAAAACGCAGATGAGGCCGGG + Intergenic
996291958 5:121861784-121861806 TAAAGAGCTCAGATGCAACCTGG + Intergenic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
997011696 5:129885846-129885868 TAAAAATCACTGCTGTAGCCAGG + Intergenic
997114014 5:131106028-131106050 TAAACATCACACATGCAGCAAGG + Intergenic
997816618 5:137025551-137025573 TCAAAAACAAAGAAGCAGCTGGG + Intronic
998105772 5:139468267-139468289 TAAAAACCACTGAGGCAGCCGGG - Intergenic
998782847 5:145677448-145677470 TAAAAAACATAATTTCAGCCAGG - Intronic
998826150 5:146103474-146103496 TAAAAAAAAAAGATTCAGTCAGG + Intronic
999199248 5:149804376-149804398 TAAAACACAGTGATGCGGCCGGG + Intronic
999378339 5:151102406-151102428 CAAAAAAGTCAGACGCAGCCAGG + Intronic
1000070381 5:157735096-157735118 TAAAAAATACAGAATCAGCCGGG - Intronic
1000317012 5:160102116-160102138 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1000317056 5:160102409-160102431 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1000569267 5:162891735-162891757 TAAAAAACCCGGATGAAGACAGG - Intergenic
1000960570 5:167596495-167596517 TAAAAAATAAAAATGCAGGCCGG + Intronic
1001365417 5:171133177-171133199 TAAAAGACAAACATTCAGCCGGG - Intronic
1001849797 5:174953474-174953496 TAAAATATACACATGCGGCCGGG - Intergenic
1002063806 5:176642341-176642363 TAAAAAACTCAGATGCCACTGGG + Intronic
1002621200 5:180489766-180489788 TAAAAATCACTTAAGCAGCCTGG + Intergenic
1002669695 5:180856657-180856679 TAAAAATGACAGAGGCGGCCGGG + Intronic
1002881644 6:1257632-1257654 TAAAAATTACAGTAGCAGCCAGG + Intergenic
1003094198 6:3129965-3129987 TAAAAAACACAAAATTAGCCAGG - Intronic
1003216683 6:4119614-4119636 TAAAAATAACACATGAAGCCAGG - Intronic
1003601685 6:7523592-7523614 TAAAAAACAAAGATGAGGCCAGG + Intergenic
1004415942 6:15424122-15424144 AAAAAAAAAAAGAGGCAGCCAGG - Intronic
1004429769 6:15532992-15533014 TAAAGATTACAGATACAGCCAGG - Intronic
1004506518 6:16251273-16251295 TGAAAAAGCCAGACGCAGCCCGG + Intronic
1004779318 6:18889768-18889790 TATAAAACACATATGCATGCAGG + Intergenic
1005042424 6:21611201-21611223 TAAAAAACACAAAATAAGCCAGG - Intergenic
1005295050 6:24417646-24417668 TAGAAAAGACAAAGGCAGCCAGG + Intronic
1005544449 6:26850367-26850389 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1006103248 6:31700041-31700063 TCAACAACGCAGATGAAGCCAGG - Intronic
1006352126 6:33528713-33528735 GAAAAAAAACAGAAGGAGCCTGG + Intergenic
1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG + Intronic
1006529683 6:34640783-34640805 TAAAGATTACAGAAGCAGCCAGG + Intronic
1006612382 6:35302020-35302042 TAAAAGACACAGATCCAGCCAGG - Intronic
1007013468 6:38439720-38439742 TAAAAGTCACAGTTGCGGCCAGG - Intronic
1007080053 6:39093911-39093933 TTAAAAATACAGATGAAGTCTGG + Intergenic
1007100714 6:39244544-39244566 TAAAGAACAAATTTGCAGCCAGG - Intergenic
1007831955 6:44645746-44645768 TCAAAAAGACAGTTGCGGCCGGG + Intergenic
1007836990 6:44681619-44681641 TAAATAAAACAGATGAATCCAGG - Intergenic
1007871294 6:45042035-45042057 TAAAAAATACAGATACAGTATGG + Intronic
1007895129 6:45347545-45347567 TAATAAACATAAATGCAGCAAGG + Intronic
1008042887 6:46820545-46820567 TAAAAAATACAGAATTAGCCAGG - Intronic
1009015237 6:57891995-57892017 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1009190813 6:60627340-60627362 TAAAAAACAAAGAGCCAGACAGG - Intergenic
1009961236 6:70524337-70524359 TAAAAGACTTAGATGCACCCTGG + Exonic
1011162335 6:84404954-84404976 TTAAAAATAAATATGCAGCCAGG - Intergenic
1011370525 6:86632653-86632675 AAAAAACCACAGATGCTGGCAGG - Intergenic
1011552543 6:88543164-88543186 AAAATAACACAGATCGAGCCAGG - Intergenic
1011670397 6:89677976-89677998 TTAAAAATACAGATTCTGCCAGG + Intronic
1013052879 6:106554315-106554337 TCAAATACACAGATGGAGGCCGG + Intronic
1013360100 6:109385916-109385938 TAAAAAGCACAGGAGGAGCCCGG + Intergenic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1013817592 6:114117317-114117339 TAGAAAACACAGAGGTAGCCTGG + Intronic
1014216164 6:118754567-118754589 TAAAAATAAAAGATGCAGGCTGG - Intergenic
1014715928 6:124864164-124864186 TAAAAAACATAAGTGCAGGCTGG + Intergenic
1014733079 6:125057476-125057498 TAAAAAACACAGTAGCAGTCTGG - Intronic
1015098855 6:129450614-129450636 TAAAAAACACAGTTGAGGCTGGG - Intronic
1015704777 6:136076173-136076195 CAAAATAAACTGATGCAGCCGGG + Intronic
1015944049 6:138482151-138482173 TAAAAAAAGAAGATGAAGCCGGG + Intronic
1016403191 6:143702401-143702423 TAAAAAACAAAAAAGCAGGCTGG - Intronic
1016413897 6:143813322-143813344 TTTAAAATTCAGATGCAGCCGGG + Intronic
1016817947 6:148320778-148320800 TAAAAAACACAAGTGAAGTCTGG - Intronic
1017159976 6:151355594-151355616 AAAAAAACAAAGATGGGGCCGGG - Intronic
1017421102 6:154274046-154274068 TAAAAAAAAAAAAAGCAGCCAGG - Intronic
1017516291 6:155158764-155158786 AAAAAAAAACACTTGCAGCCTGG - Intronic
1017756893 6:157537111-157537133 TTAAAAAGATAGATGGAGCCGGG - Intronic
1017762165 6:157577845-157577867 AAAAAATAACAGATGCAGGCTGG - Intronic
1018453920 6:163935473-163935495 TAAAAAATATAAATGCACCCTGG + Intergenic
1019393601 7:804150-804172 TCAAAAATCCAGATCCAGCCAGG - Intergenic
1019508915 7:1407511-1407533 TTAAATACACAGATTTAGCCAGG - Intergenic
1019757890 7:2787022-2787044 CCAAACACACAGAGGCAGCCTGG + Intronic
1019839143 7:3421815-3421837 TAAATAACAGAGCTGCTGCCAGG + Intronic
1019987432 7:4667976-4667998 TAAAAAACAAAAATGAAGCTCGG + Intergenic
1020221039 7:6237412-6237434 TATTAAAAACACATGCAGCCCGG + Intronic
1020514040 7:9093778-9093800 GAAATAACACAAATCCAGCCAGG + Intergenic
1020668607 7:11077304-11077326 AAAAAAAGCCAGATTCAGCCGGG + Intronic
1020884318 7:13803496-13803518 TAAAAAAAACACCTGCAGCTAGG - Intergenic
1022351827 7:29573320-29573342 TCATAAAAACTGATGCAGCCTGG - Intergenic
1023311202 7:38888217-38888239 TAAAAGACACAGACGCAAACTGG + Intronic
1023774865 7:43595569-43595591 TAAAAAAGCCAGTTGAAGCCAGG - Intronic
1024017072 7:45326829-45326851 TGACAAACACAGATGCACTCGGG + Intergenic
1024185541 7:46944840-46944862 TAAAAGTCAAAGATTCAGCCAGG - Intergenic
1024489997 7:49970717-49970739 TAGAAAACATAAAAGCAGCCAGG + Intronic
1024656992 7:51459285-51459307 TCAGAAACACAGCTGGAGCCTGG - Intergenic
1025098354 7:56115280-56115302 TAAAAAAAATAGATGCAGGTAGG - Intronic
1025168633 7:56735925-56735947 TAAAAAACACAAAAGTGGCCGGG - Intergenic
1025703754 7:63843956-63843978 TAAAAAACACAAAAGTGGCCAGG + Intergenic
1026172309 7:67964725-67964747 TAAGAAACACAGATTCAGCTGGG + Intergenic
1026300070 7:69090027-69090049 TAGAACACAGAGATGCAGACAGG + Intergenic
1026664023 7:72326369-72326391 GAAGAAACAGAGATGTAGCCAGG - Intronic
1026974039 7:74485624-74485646 AAAAAAAAATAGATGCAGCTGGG + Intronic
1027121646 7:75526702-75526724 CAAAAAATACAAAAGCAGCCAGG - Intergenic
1027150392 7:75729488-75729510 TAAAAAACAAAAAAGCGGCCGGG + Intronic
1028468559 7:91179505-91179527 TAAAAAAAAAAAATGCAGCCCGG + Intronic
1029269006 7:99365288-99365310 TAAAAAAGCCAGGTGCAGCCAGG + Intronic
1029746558 7:102518293-102518315 TAAAAAACATAAAAACAGCCAGG - Intergenic
1029764495 7:102617272-102617294 TAAAAAACATAAAAACAGCCAGG - Intronic
1030266344 7:107625970-107625992 TAAAAAAGAAAAATGCAGCTAGG + Intronic
1030325046 7:108210539-108210561 TAAAAAACACAGTTGGGACCAGG - Intronic
1031036517 7:116793601-116793623 ATAAGAACACATATGCAGCCAGG + Intronic
1031259607 7:119501721-119501743 TAAAATCCACACATACAGCCAGG + Intergenic
1031282723 7:119824254-119824276 TAAATAAAACTGATGGAGCCCGG - Intergenic
1032225187 7:130025571-130025593 TATAGAACACAAATTCAGCCTGG + Intronic
1032346364 7:131120179-131120201 AAAAAAAAAAAGAAGCAGCCAGG + Intronic
1033423834 7:141225689-141225711 TAAAAATGACAGATGTAGCTGGG - Intronic
1033434536 7:141321122-141321144 TTAAGAACACAGTTACAGCCTGG + Intronic
1033450487 7:141458278-141458300 TAAAAAATACAAAATCAGCCGGG - Intronic
1033928499 7:146494035-146494057 TAAAAAATAAAAATGCAGGCCGG + Intronic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1034211814 7:149370338-149370360 AAAAAAATACAGATGAGGCCAGG - Intergenic
1034346678 7:150389506-150389528 TCCAAAACACACATGCAGCTAGG - Intronic
1034614307 7:152401813-152401835 TAAAAAGAAGAGTTGCAGCCGGG + Intronic
1034848484 7:154470953-154470975 CGAAAAACACAGCTGCAGCCGGG + Intronic
1035005733 7:155658692-155658714 TTAAAAACAAACAAGCAGCCGGG - Intronic
1035146584 7:156823793-156823815 TATAATACACACATGCAGCCGGG + Intronic
1035179073 7:157076368-157076390 CAAAAAACAAAGATGCAGGCTGG - Intergenic
1035461015 7:159039161-159039183 TTAAAAATACACATGCAGCCGGG + Intronic
1035680808 8:1486397-1486419 TAAACAACACAGATCCAGAGAGG - Intergenic
1035721219 8:1794499-1794521 TAAAAAAGCCAGGAGCAGCCAGG - Intergenic
1036386119 8:8283291-8283313 TAAAAAGAACAGAAGGAGCCAGG - Intergenic
1037484229 8:19332338-19332360 TAAAATAGGCACATGCAGCCAGG + Intronic
1037656780 8:20890672-20890694 TGAATAACACAGATGTAGTCTGG - Intergenic
1038294191 8:26275776-26275798 TAAAAAAATCTGATGAAGCCAGG + Intergenic
1038774855 8:30519786-30519808 TAAAAAAGAGAGATCCGGCCAGG - Intronic
1038817427 8:30919354-30919376 TAGAAAAAACAGATCCAACCAGG + Intergenic
1041309471 8:56500778-56500800 TAAAAATCATAGATACAGCCAGG + Intergenic
1041371654 8:57167181-57167203 TGAAAAGCACAAATGGAGCCAGG + Intergenic
1041496387 8:58489846-58489868 TAAAACACATAGATTCGGCCAGG + Intergenic
1043470045 8:80553289-80553311 TAAAACACATAGATGAGGCCGGG + Intergenic
1043479769 8:80641256-80641278 AATAAAACACAGTTGAAGCCAGG - Exonic
1043683960 8:83065476-83065498 TAAAAAAGTCAGATGTGGCCGGG - Intergenic
1043817854 8:84825338-84825360 TAAAAACCACAGATGTTGGCAGG + Intronic
1044162920 8:88943181-88943203 TAAAAAATACAAATCCAGCCAGG - Intergenic
1044751211 8:95417463-95417485 CAAAGAACACAGAAGCAGCCTGG - Intergenic
1045068868 8:98479190-98479212 TAAAAGACAAAGAAGCGGCCGGG + Intronic
1045484826 8:102622651-102622673 TTAAAAATTCAGATGCAGCCAGG - Intergenic
1045679863 8:104647019-104647041 CAAAAAAAAAAAATGCAGCCAGG + Intronic
1046215759 8:111144012-111144034 CAAAAAACATAGATGCATCAGGG + Intergenic
1047722738 8:127656765-127656787 TTAAAAAGAAAGATGCGGCCGGG + Intergenic
1048247709 8:132826886-132826908 TAAAAAATACAAATCCAACCGGG + Intronic
1048380053 8:133857545-133857567 TAAAAAACACCAATGCAGAGGGG - Intergenic
1048464985 8:134658040-134658062 TAAAAAATAAATATGCGGCCGGG + Intronic
1048856788 8:138693225-138693247 CCAAACACACAGATGCAGCCAGG - Intronic
1049114902 8:140677872-140677894 TATAAAACAAAGATCCTGCCTGG + Intronic
1049135251 8:140892237-140892259 ACAAAACCACAGATCCAGCCAGG + Intronic
1049788073 8:144460720-144460742 TAAAAAATACAAAAACAGCCGGG + Intronic
1049837677 8:144748874-144748896 TAGAAAACACAGTTGGGGCCAGG + Intronic
1049974035 9:845016-845038 TAAAAAACACAACTACAGGCCGG - Intronic
1050330108 9:4537262-4537284 TAAAAAAATCACATGCGGCCGGG + Intronic
1050353835 9:4764550-4764572 TAAAAAATAGAGATGGAGTCAGG + Intergenic
1050440228 9:5654211-5654233 AAAAATACACACTTGCAGCCTGG - Intronic
1051087143 9:13363054-13363076 TACAAAACACAGAAGCAGGAGGG + Intergenic
1051547813 9:18295631-18295653 TAAGAATAACAGTTGCAGCCGGG - Intergenic
1051660590 9:19422733-19422755 TTAAAAACACAAAAGCAGGCGGG + Intronic
1051768954 9:20555441-20555463 TCAAGAACTCAGTTGCAGCCTGG - Intronic
1052483808 9:29069000-29069022 TGCAAAACTCAGATGTAGCCTGG - Intergenic
1052743478 9:32416386-32416408 TAGAAAACACATCTGGAGCCGGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053248295 9:36553387-36553409 TCAAAAACACATACACAGCCGGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053707775 9:40771728-40771750 CTAAAAACACATTTGCAGCCAGG + Intergenic
1054417685 9:64892512-64892534 CTAAAAACACATTTGCAGCCAGG + Intergenic
1054772497 9:69095868-69095890 TTTAAAACATAGATCCAGCCAGG - Intronic
1055024545 9:71705931-71705953 TAAAAAGCACATATTCGGCCAGG + Intronic
1055437902 9:76310781-76310803 AAAAAATGCCAGATGCAGCCGGG + Exonic
1055452009 9:76439518-76439540 TTAAAAACACAAATGGGGCCAGG - Intronic
1055593315 9:77840630-77840652 TAAAACAATCAAATGCAGCCAGG - Intronic
1055663653 9:78532138-78532160 TTAAAAATATAGATGCAGGCCGG + Intergenic
1056225989 9:84495898-84495920 AAAAAAAGACAGACGCAGCCGGG - Intergenic
1056360968 9:85857126-85857148 TAAAAATCCCAGATGAGGCCAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057132278 9:92662363-92662385 TAAAAAACACAAAATTAGCCCGG + Intronic
1057174964 9:92989419-92989441 TAAAAAACACTGATGAGGCCAGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058169130 9:101657871-101657893 AAAGAGACACAGATGCAGGCAGG - Intronic
1058916256 9:109568689-109568711 GAAAACACACACATGCTGCCTGG - Intergenic
1059846872 9:118289574-118289596 TAAAAAATGCAGATGGACCCAGG - Intergenic
1060066630 9:120507652-120507674 CAAATAAAACAGATGCACCCGGG - Intronic
1060076795 9:120598019-120598041 TCAAGAACAGAGATGTAGCCTGG - Intergenic
1060503083 9:124177835-124177857 TAAAAAACATATATGGAGCCAGG - Intergenic
1060667609 9:125441830-125441852 TAAAAATCAGAGATGGGGCCGGG + Intronic
1060765022 9:126288871-126288893 TAAAAAAAATAGATTCAGCCGGG + Intergenic
1061152527 9:128836996-128837018 TAAAGAACACAGCTGCGGCCAGG + Intronic
1061247399 9:129407695-129407717 TTAAAAACACAAATCAAGCCGGG + Intergenic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1061459700 9:130727360-130727382 TAAAAAAGAGAGATACCGCCAGG - Intronic
1061631663 9:131875902-131875924 TGTAAAACAGAGACGCAGCCGGG - Intronic
1061730446 9:132609913-132609935 TAAGAAACACACATGTGGCCAGG - Intronic
1061786468 9:133031510-133031532 TAAAAAATACAAATTTAGCCGGG - Intronic
1185602456 X:1349605-1349627 TAAAAAACAAAGAAGAGGCCAGG - Intronic
1185653895 X:1668963-1668985 TCAAAAACAAAGAAACAGCCGGG - Intergenic
1185722111 X:2390431-2390453 TAAAAAAAAAAAATGCAGCTGGG - Intronic
1186513627 X:10149711-10149733 TAAAATACAAAAATGTAGCCGGG + Intergenic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1186821707 X:13294955-13294977 AAAAAAACAGCGTTGCAGCCTGG - Intergenic
1186846884 X:13539749-13539771 TAAAAAACACAGATGGAATCTGG - Intergenic
1187118478 X:16379707-16379729 TAAAAAAAGCATATGGAGCCAGG + Intergenic
1187157164 X:16731642-16731664 TAAAAATTACACAAGCAGCCGGG + Intronic
1187379254 X:18785585-18785607 AAAAAATCCCAGTTGCAGCCAGG + Intronic
1187407521 X:19017022-19017044 TTAAAAACATTGATGCAGCTGGG - Intronic
1187425255 X:19171858-19171880 TAAAAAGCAGAGATGGGGCCTGG + Intergenic
1187511856 X:19926929-19926951 TTAAAAAAAGAGATGCGGCCGGG + Intronic
1187687121 X:21826856-21826878 TCAAAAACACAGAGAGAGCCAGG + Intergenic
1187871485 X:23768358-23768380 TAAAAAAAACAGACGTGGCCGGG - Intergenic
1187979207 X:24737226-24737248 TTAAAAACACAGAACCTGCCTGG - Intronic
1188626660 X:32293443-32293465 TCAACAAGTCAGATGCAGCCAGG + Intronic
1189490788 X:41470396-41470418 TAAAAATCATTGATGCAGCTGGG + Intronic
1189782412 X:44528855-44528877 TAAAAAACAAAAAATCAGCCGGG - Intronic
1189913660 X:45836231-45836253 TAAAAAATACAAATTTAGCCAGG + Intergenic
1189993045 X:46612629-46612651 TAGAAAACTGAGATGCAGGCCGG + Intronic
1189993337 X:46615027-46615049 CAAAAAACAGAGCTCCAGCCAGG - Intronic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1190264389 X:48818695-48818717 CATACAACACAGATCCAGCCAGG - Intronic
1190286466 X:48964726-48964748 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1190883081 X:54507260-54507282 TAAAAAAAACAGAATTAGCCAGG - Intergenic
1190911848 X:54778489-54778511 TAAAAAACTCAGGTGCAGGCCGG - Intronic
1193149180 X:78106711-78106733 TAAAAAACTAAGATGGAACCTGG - Intronic
1193990295 X:88299081-88299103 TTAAATACACAGCTGCAGTCAGG + Intergenic
1194449935 X:94032240-94032262 TAAAGAAAACAGATGAGGCCAGG + Intergenic
1194820641 X:98502465-98502487 TAAAAAATACAAATATAGCCGGG + Intergenic
1194975650 X:100393868-100393890 TAAGAAGCCAAGATGCAGCCAGG + Intronic
1195722265 X:107878229-107878251 AGAAAATCACAGCTGCAGCCAGG - Intronic
1196116180 X:112002046-112002068 TATAAAGGACAGAAGCAGCCAGG - Intronic
1196383990 X:115127981-115128003 CAAAGAACACAGATGCAATCAGG - Intronic
1196500671 X:116377692-116377714 TAAAAACCAGAGATGTAGCCAGG + Intergenic
1196709630 X:118749209-118749231 TAAAAAATAAACATTCAGCCAGG - Intronic
1197175817 X:123484776-123484798 GCCAAAACACAAATGCAGCCGGG - Intronic
1197217522 X:123880439-123880461 TAAAAAAAAAAAAAGCAGCCTGG + Intronic
1198308474 X:135405795-135405817 TAAAACACACAGATGTGGCCGGG + Intergenic
1198875197 X:141217208-141217230 TAAGAAACACAGAAGGGGCCGGG + Intergenic
1199856408 X:151762343-151762365 TTAAAAACACAGATGCCGGCCGG + Intergenic
1200788779 Y:7281570-7281592 AAAAAAAAAAAGAGGCAGCCGGG - Intergenic
1201363287 Y:13176312-13176334 TAAAAAATACAGAAGCAGGCTGG - Intergenic
1201375790 Y:13317297-13317319 TAAAGAGCACACAAGCAGCCGGG - Intronic
1201512812 Y:14784363-14784385 TCAAAAAGACACATGCGGCCGGG + Intronic