ID: 1138646110

View in Genome Browser
Species Human (GRCh38)
Location 16:58426228-58426250
Sequence TTTGTGGTGGGACGTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138646110_1138646119 23 Left 1138646110 16:58426228-58426250 CCTGCCACACGTCCCACCACAAA No data
Right 1138646119 16:58426274-58426296 AGAGGGCAGAAAGGCCAGCTCGG No data
1138646110_1138646118 14 Left 1138646110 16:58426228-58426250 CCTGCCACACGTCCCACCACAAA No data
Right 1138646118 16:58426265-58426287 GACACATGCAGAGGGCAGAAAGG No data
1138646110_1138646117 6 Left 1138646110 16:58426228-58426250 CCTGCCACACGTCCCACCACAAA No data
Right 1138646117 16:58426257-58426279 GTCTCAGAGACACATGCAGAGGG No data
1138646110_1138646116 5 Left 1138646110 16:58426228-58426250 CCTGCCACACGTCCCACCACAAA No data
Right 1138646116 16:58426256-58426278 AGTCTCAGAGACACATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138646110 Original CRISPR TTTGTGGTGGGACGTGTGGC AGG (reversed) Intergenic
No off target data available for this crispr