ID: 1138646554

View in Genome Browser
Species Human (GRCh38)
Location 16:58429891-58429913
Sequence TTGTTGTTGTTGTTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138646549_1138646554 28 Left 1138646549 16:58429840-58429862 CCTTAGCCTCTCAAGTAGCTGGG 0: 188
1: 7849
2: 108481
3: 221889
4: 262995
Right 1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG No data
1138646551_1138646554 22 Left 1138646551 16:58429846-58429868 CCTCTCAAGTAGCTGGGACTACA 0: 2026
1: 49269
2: 166609
3: 229345
4: 235035
Right 1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138646554 Original CRISPR TTGTTGTTGTTGTTGAAACA GGG Intergenic
No off target data available for this crispr