ID: 1138649734

View in Genome Browser
Species Human (GRCh38)
Location 16:58452877-58452899
Sequence CATCACATGGGGCTGTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138649723_1138649734 19 Left 1138649723 16:58452835-58452857 CCTCAGTTTCCTAATCTGTAAAC 0: 5
1: 111
2: 1821
3: 6914
4: 15204
Right 1138649734 16:58452877-58452899 CATCACATGGGGCTGTTATGAGG No data
1138649722_1138649734 29 Left 1138649722 16:58452825-58452847 CCTTTCTAGGCCTCAGTTTCCTA No data
Right 1138649734 16:58452877-58452899 CATCACATGGGGCTGTTATGAGG No data
1138649727_1138649734 10 Left 1138649727 16:58452844-58452866 CCTAATCTGTAAACTGGGGACAA No data
Right 1138649734 16:58452877-58452899 CATCACATGGGGCTGTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138649734 Original CRISPR CATCACATGGGGCTGTTATG AGG Intergenic
No off target data available for this crispr