ID: 1138651278

View in Genome Browser
Species Human (GRCh38)
Location 16:58463115-58463137
Sequence GGAGCCCGAGGGTGTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138651278_1138651286 -8 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651286 16:58463130-58463152 CGGGCTCCGAAAACGGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 34
1138651278_1138651289 -5 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651289 16:58463133-58463155 GCTCCGAAAACGGGGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 120
1138651278_1138651291 10 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651291 16:58463148-58463170 GGAGGGGGACGACGCCCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 172
1138651278_1138651288 -6 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651288 16:58463132-58463154 GGCTCCGAAAACGGGGGGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 112
1138651278_1138651294 25 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651294 16:58463163-58463185 CCCAGAGGCCCCTGAGCCCCTGG 0: 1
1: 1
2: 9
3: 103
4: 747
1138651278_1138651287 -7 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651287 16:58463131-58463153 GGGCTCCGAAAACGGGGGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138651278 Original CRISPR GGAGCCCGAGGGTGTCCTTG AGG (reversed) Intronic