ID: 1138651278

View in Genome Browser
Species Human (GRCh38)
Location 16:58463115-58463137
Sequence GGAGCCCGAGGGTGTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138651278_1138651286 -8 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651286 16:58463130-58463152 CGGGCTCCGAAAACGGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 34
1138651278_1138651287 -7 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651287 16:58463131-58463153 GGGCTCCGAAAACGGGGGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 94
1138651278_1138651288 -6 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651288 16:58463132-58463154 GGCTCCGAAAACGGGGGGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 112
1138651278_1138651289 -5 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651289 16:58463133-58463155 GCTCCGAAAACGGGGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 120
1138651278_1138651294 25 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651294 16:58463163-58463185 CCCAGAGGCCCCTGAGCCCCTGG 0: 1
1: 1
2: 9
3: 103
4: 747
1138651278_1138651291 10 Left 1138651278 16:58463115-58463137 CCTCAAGGACACCCTCGGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1138651291 16:58463148-58463170 GGAGGGGGACGACGCCCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138651278 Original CRISPR GGAGCCCGAGGGTGTCCTTG AGG (reversed) Intronic
900176077 1:1291979-1292001 GCAGCCCAAGTGTGTCCGTGGGG - Exonic
900245502 1:1634362-1634384 GCAGCCCGCGGGCGGCCTTGGGG + Intronic
900256733 1:1701521-1701543 GCAGCCCGCGGGCGGCCTTGGGG + Intronic
900475751 1:2875650-2875672 GGAGGACGAGGGGCTCCTTGAGG + Intergenic
900608978 1:3536477-3536499 GGAGCCCGGGCGTGGCCGTGGGG + Intronic
900715296 1:4140204-4140226 GGAGCCCATGGGAGCCCTTGAGG - Intergenic
900917301 1:5647732-5647754 CAACCCCGAGGGTGGCCTTGGGG + Intergenic
902323380 1:15683741-15683763 GGAGTCTGAGGGTGTCTCTGAGG + Intergenic
902970203 1:20042897-20042919 GGAGCAGGAGGGTGTCCTGTTGG + Intronic
903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG + Intergenic
904778264 1:32925110-32925132 GGCGCCCGCGGGGGTCCCTGGGG + Intergenic
905658800 1:39703907-39703929 GGAGGCCGAGGTGGCCCTTGAGG - Intronic
905974327 1:42164164-42164186 GGACCTCCAGGGTGTCCATGTGG + Intronic
906378909 1:45319049-45319071 GGAGCAGGAGGGTGTCCTGTTGG - Intergenic
907266176 1:53262847-53262869 AGAGCCCTAGGGTGTCAGTGTGG + Intronic
907270702 1:53289281-53289303 GGAGCCCTAGCGTGTCCTCCAGG - Intronic
909490355 1:76219521-76219543 GGAGTCTGAGGGGGTCCTTGAGG + Intronic
910127543 1:83860686-83860708 GGAGCCCGAGTGGGCCCTGGCGG - Intergenic
911467054 1:98268647-98268669 GGAGCAAGAGAATGTCCTTGGGG - Intergenic
915441234 1:155946731-155946753 TGAGGCAGAGGCTGTCCTTGCGG + Intergenic
915835821 1:159173569-159173591 GGAGCTGAAGGGAGTCCTTGGGG + Intronic
919776114 1:201194959-201194981 GGAGGCTGAGGGATTCCTTGAGG + Intronic
919787889 1:201271456-201271478 GGAGCTTGAGGGGGACCTTGAGG + Intergenic
919907401 1:202087269-202087291 GGAGCCAGAGGGTGTGTATGGGG + Intergenic
920226913 1:204445966-204445988 GGAGCCCCAGGGCATCCTGGTGG + Exonic
922500785 1:226095518-226095540 GGAGCTGGAGGGAGTCCTAGAGG + Intergenic
924694083 1:246381977-246381999 GGAGCCCGCGGTTGGCCTGGAGG - Intronic
1064164132 10:12972328-12972350 GAAGCCCAAGGGTGTGCCTGGGG - Intronic
1065636933 10:27743244-27743266 TCAGGCCGAGGTTGTCCTTGAGG + Exonic
1065966530 10:30775301-30775323 GGAGGCCGAGGCTGGGCTTGAGG - Intergenic
1069883461 10:71608669-71608691 GGAGACCCAGCGTGGCCTTGAGG - Intronic
1070786248 10:79163787-79163809 GGAGCCAGAGGGTGGCCCTCAGG + Intronic
1070853201 10:79584310-79584332 GGAGCCCCTGGGTTTCCTGGGGG + Intergenic
1071187439 10:83060644-83060666 GGAGCAAGAGGGTGTCCTCTTGG - Intergenic
1071260180 10:83912542-83912564 GGAGGCCGGGGGTGTCCATCTGG - Intergenic
1072253783 10:93601403-93601425 TGTGCCCGAGGCTGTCCTGGAGG - Exonic
1072738222 10:97893700-97893722 GCAGCCCGAGAGGGTCTTTGTGG - Intronic
1076582362 10:131520266-131520288 GGAGTCCCAGAGGGTCCTTGGGG + Intergenic
1077081298 11:725849-725871 TGAGCCCGCGGGGGTCCCTGGGG + Intronic
1077107455 11:848328-848350 GAAGCCCCAGGATGGCCTTGTGG + Intronic
1077254259 11:1573341-1573363 AGAGCCCCAGGGTGACCCTGGGG - Intergenic
1079115253 11:17636485-17636507 GAAGCCCTTGGGTGTCCTGGTGG - Intronic
1082785485 11:57314006-57314028 GGAACCCGAGGGGGTCCTCTTGG + Intronic
1083429924 11:62609007-62609029 GGAGGCCCAGGGGGTCCTGGAGG - Exonic
1083476378 11:62918392-62918414 GGAGCCTGAGGGTGAACCTGTGG + Intronic
1083955122 11:65978683-65978705 GGAGGCGGTGGGTGCCCTTGGGG + Exonic
1084203481 11:67577357-67577379 GGAAGCCGAGGGTCTCCTTCGGG + Intergenic
1084780443 11:71404720-71404742 AGAGACCCAGGGTGTCCTTCGGG - Intergenic
1088604214 11:111512802-111512824 TGGGCCCGGGGGTGTCCTCGGGG + Intergenic
1089100958 11:115962004-115962026 GGAGCCTGAGAGTGTCCTCCAGG + Intergenic
1091317473 11:134624629-134624651 GGAGCAAGAGGGTGACTTTGGGG + Intergenic
1091449038 12:561448-561470 GTAGCCGGAGGGTGTCCGCGGGG + Exonic
1092480466 12:8854776-8854798 GCAGCCTGAGGGAGTCCTGGTGG + Exonic
1093302504 12:17473433-17473455 GGAGCACGAGTGTGTCCTGTTGG - Intergenic
1093909251 12:24727050-24727072 GGAGACTGAGGGGCTCCTTGAGG - Intergenic
1094131340 12:27078920-27078942 GGAGCAAGAGGGTCCCCTTGGGG + Intergenic
1096812037 12:54176906-54176928 GGAGACCAAGGGTGTGCTTGGGG - Intronic
1096914820 12:55020082-55020104 TCAGCCCGAAGGCGTCCTTGAGG + Exonic
1097144633 12:56931730-56931752 GGAGCTGGAAGGGGTCCTTGAGG - Intronic
1097210892 12:57368839-57368861 TGAACCCGAGGGTGATCTTGCGG + Intronic
1103972044 12:124678585-124678607 GGCCCCCGGGGGTGGCCTTGAGG + Intergenic
1104720227 12:131041263-131041285 GGAGCCGGAGGGTGTGGGTGGGG + Intronic
1106037013 13:26052104-26052126 GGCGCCCGCGGGCGTCCCTGAGG - Intergenic
1106312995 13:28570070-28570092 TGAGCCCCAGGCTGACCTTGAGG + Intergenic
1113167840 13:107462967-107462989 GGAGCCTGAGGGTGGTCTTGGGG + Intronic
1113842322 13:113367169-113367191 GGAGCTCCAGGCTGTCCTGGAGG + Intergenic
1114452604 14:22836972-22836994 CGAGCCCGGGGGTCTCCTAGGGG + Intronic
1114770848 14:25427913-25427935 AGAGCAGGAGGGTGTCCTTTTGG + Intergenic
1117174347 14:53131788-53131810 GGAGCAGGAGGGTGTCCTGTTGG - Intronic
1122125193 14:99575037-99575059 GCAGCCAGAGGGTGGCCTTTTGG + Intronic
1122207567 14:100155636-100155658 GGAGCCCCAGGATCCCCTTGTGG + Intronic
1122352210 14:101102858-101102880 GGAGCCCCAGGGAGCCCTGGGGG + Intergenic
1122796736 14:104209901-104209923 GGAGCACAAGCGTGTCTTTGGGG - Intergenic
1123027362 14:105433016-105433038 TGAACCCGAGGGTGGTCTTGGGG - Intronic
1123138784 14:106055210-106055232 GAAGCCCGAGTGTCACCTTGGGG - Intergenic
1123934944 15:25189582-25189604 GCACCCCGAAGGTGTCCTTCAGG - Intergenic
1124416556 15:29477267-29477289 GGAGCACAAGGGGGACCTTGAGG + Intronic
1128212214 15:65910636-65910658 GGAGGCTGAGAGTGGCCTTGGGG + Intronic
1128865300 15:71110616-71110638 GGAGCCCGCTGCTGTCCTGGAGG - Exonic
1129746395 15:78024434-78024456 GAAGCTCGAGCGTGTCCTTTGGG + Exonic
1129852255 15:78800215-78800237 TGAGCTCGAGGGTGGCCTGGCGG - Exonic
1130250743 15:82298858-82298880 CGAGCTCGAGGGTGGCCTGGCGG + Intergenic
1132110440 15:99098845-99098867 GGAGCCAGGAGGTTTCCTTGTGG + Intronic
1132845609 16:1999589-1999611 GGAGCCCAGGGGGTTCCTTGGGG + Exonic
1133630534 16:7616111-7616133 GGAGCCTGAGAGTGGTCTTGGGG - Intronic
1134044155 16:11089046-11089068 GGAGGGGGAGGGTGTCCTTCTGG + Intronic
1138651278 16:58463115-58463137 GGAGCCCGAGGGTGTCCTTGAGG - Intronic
1141507097 16:84485088-84485110 GGAGCCCGAGGCTGGGCTGGTGG + Intronic
1143055864 17:4161311-4161333 GCAGCCAGAGGCTGTCCTTGCGG + Intronic
1143541990 17:7574287-7574309 GGAGCCCGAAGGCGTCATCGAGG + Exonic
1144639680 17:16930590-16930612 GGAGCTCGAGGCTGGCCTGGAGG + Intronic
1144676874 17:17167681-17167703 GGAGGCAGAGGGTGTCCTGAAGG - Intronic
1144816700 17:18039922-18039944 GGGGCCCGAGGGCCTCCTCGCGG + Intronic
1145785744 17:27592744-27592766 GTGGCCAGAGGGTGGCCTTGGGG + Intronic
1147643167 17:42017505-42017527 CGAGCCCGAGGGAGCCCTTCTGG - Exonic
1151392624 17:73797855-73797877 TGAGCCAGAGGCTGTCCCTGTGG + Intergenic
1152201816 17:78951825-78951847 GGAGCCGGAGGCTGGCATTGCGG + Intergenic
1152545234 17:80997114-80997136 GGCCCTCGAGGGTGGCCTTGTGG - Intronic
1158576613 18:58644020-58644042 GGAGCAGGAGGGTGTCCTGTTGG + Intergenic
1160934654 19:1588161-1588183 GGAGCCTGCCCGTGTCCTTGTGG - Intronic
1161234267 19:3190171-3190193 AGACCTCGAGGGAGTCCTTGGGG - Intronic
1161712324 19:5855917-5855939 GGAGCAGGAGGGTGTCCTGTTGG - Intergenic
1162262421 19:9543735-9543757 GGAGCCGGAGGGTGTCCTGTTGG - Intergenic
1162418402 19:10552129-10552151 GGAGCCCCAGTGTGTGGTTGGGG + Intronic
1163251532 19:16128838-16128860 GGAGACTGAAGGTGTTCTTGGGG - Intronic
1163343321 19:16724037-16724059 GGAGCTTGAGGGTGCTCTTGGGG + Intronic
1164492313 19:28726908-28726930 GGAGCCAGTGGCTGTCCTTGTGG - Intergenic
1165865180 19:38932592-38932614 GGAGCACCAGATTGTCCTTGTGG + Exonic
1167284196 19:48589563-48589585 TGAGCCTGAGGGTGGTCTTGGGG - Intronic
1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG + Intronic
931232389 2:60385844-60385866 TGAGCCAGAGGGTGTCCTCTAGG - Intergenic
932380932 2:71282082-71282104 TGAACCTGAGGGTGGCCTTGGGG - Intronic
937433447 2:121860418-121860440 GGAGCCTGTGGGTTTCCTTGAGG - Intergenic
939725879 2:145721002-145721024 GGAGCCACAGGGAGTCTTTGTGG + Intergenic
941651237 2:168094704-168094726 GGAGCCCTGGGGAGTCCTGGGGG - Intronic
1169197318 20:3690208-3690230 GGAGCCTGAGGGTGGCCTCCGGG - Exonic
1170855436 20:20049185-20049207 GGAACCCTAGGGTTCCCTTGAGG - Intronic
1174747256 20:53075719-53075741 GGAGACTGAGGGAGTTCTTGGGG + Intronic
1175924547 20:62465439-62465461 GGAGGCCGAGGCATTCCTTGTGG + Exonic
1175980254 20:62735197-62735219 GGAGGCCACGGGTGCCCTTGGGG + Intronic
1176427989 21:6560503-6560525 GGAGCCCCAGGGTGCCCAGGCGG + Intergenic
1178054257 21:28781448-28781470 TGAGCCTGAGGGTGATCTTGGGG - Intergenic
1179542010 21:42089155-42089177 GGAGCCCAGGGGTTTGCTTGCGG - Intronic
1179703480 21:43168820-43168842 GGAGCCCCAGGGTGCCCAGGCGG + Intergenic
1180079023 21:45477906-45477928 GGAGGCCCTGGGGGTCCTTGTGG - Exonic
1181749278 22:24977566-24977588 GGAGCCCCAGGGTGGGCTGGGGG - Intronic
1183584127 22:38742375-38742397 GCAGCGCCAGGGTGTCCTCGTGG + Exonic
1184426795 22:44413742-44413764 GGAGGAGGAGGGTATCCTTGGGG + Intergenic
1184620780 22:45674559-45674581 GGAGCCAGTGTTTGTCCTTGGGG + Intronic
1185059821 22:48600417-48600439 GGGGCCCGAGGCAGCCCTTGTGG + Intronic
1185305268 22:50112035-50112057 GCAGCCGGAGGGTGGACTTGGGG + Intronic
1203282579 22_KI270734v1_random:138454-138476 GGAGGCTGAGGGTGTGCTGGCGG + Intergenic
950143072 3:10628456-10628478 GGAGGCAGAGGATGTCCTAGAGG - Intronic
953834292 3:46329718-46329740 GGAGCAGGAGGGTGTCCTGTTGG + Intergenic
956277721 3:67521239-67521261 GGGGCCCGAGGGTTTATTTGAGG - Intronic
957985886 3:87572810-87572832 GGAGCAGGAGGGTGTCCTGCTGG - Intergenic
961058761 3:123810794-123810816 GGAACTGGAGGGTGTCCTTTGGG - Intronic
961772577 3:129260818-129260840 GGGGGCCGTGGGTGTCCTGGGGG - Intronic
966928863 3:184662903-184662925 GGGGCCCGACGGTGTGCTGGGGG + Intronic
967166561 3:186784456-186784478 GGACCCCGATGGTGTCATCGAGG + Exonic
968285121 3:197504065-197504087 GTAGCCCAAGGGTGTTCTAGAGG - Intergenic
971487244 4:27172682-27172704 GGAGCACCAGGGTGTCCTGAGGG - Intergenic
973756166 4:54075784-54075806 GGAGGCCGAGGCGGGCCTTGAGG - Intronic
978407303 4:108394186-108394208 GGAGCTAGAGACTGTCCTTGTGG + Intergenic
979231579 4:118353166-118353188 CGAGCCCGAGGGTGCCCGCGCGG + Intergenic
984183637 4:176515394-176515416 GATGCCCCAGGGTTTCCTTGAGG - Intergenic
985590067 5:759918-759940 GGGGCCCGAGGGGGTCGCTGAGG + Intronic
986010900 5:3714271-3714293 GGAGACAGAGGGTCTCCTGGAGG + Intergenic
988493177 5:31722317-31722339 GGAACCCAAGGGCGTGCTTGAGG - Intronic
990491526 5:56307761-56307783 GAAGCCTGAGGGTGGTCTTGAGG - Intergenic
991720774 5:69492933-69492955 GGAGCCCGAGGGTCCCCGTGGGG + Intronic
994325084 5:98438056-98438078 GGAGCAGGAGGGTGTCCTGTTGG - Intergenic
996052430 5:118949108-118949130 GGAGCAGAAGGGTGTCCTTTTGG + Intronic
997233811 5:132261166-132261188 GGAGGCAGAGGATGGCCTTGAGG + Intronic
1000607141 5:163337516-163337538 GGAGCAGGAGGGTGTCCTGTTGG - Intergenic
1001080267 5:168662425-168662447 AGAGCCCCAGGGTGACCTTCAGG - Intronic
1002416625 5:179124195-179124217 TGAGCCTGAGGGTGGTCTTGGGG + Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006452061 6:34110994-34111016 GCAGCCTGAGGGTGCCCATGGGG - Intronic
1006896680 6:37475686-37475708 TGAGCAAGAGGGTGACCTTGCGG + Intronic
1009027400 6:58016442-58016464 AGAGCCCAAGGGTGCTCTTGAGG - Intergenic
1009202937 6:60767925-60767947 AGAGCCCAAGGGTGCTCTTGAGG - Intergenic
1009464532 6:63953375-63953397 GGAGCAGGAGGGTGTCCTGTTGG - Intronic
1013468301 6:110436919-110436941 TGAGACCCAGGGTGGCCTTGCGG + Intronic
1015502874 6:133952227-133952249 GGGGCCCGAGTGCGTCCTCGGGG - Intronic
1019257535 7:61710-61732 GGCGACAGAGGGTGTCTTTGTGG + Intergenic
1019420041 7:946527-946549 AGAGCCTGGGGGGGTCCTTGGGG - Intronic
1023746715 7:43329084-43329106 GGAGCCCTAGCCTGACCTTGGGG + Intronic
1023865951 7:44238561-44238583 GGAGGCCCAGGGCGTCCTCGGGG - Intronic
1024961382 7:54980688-54980710 GGCGCCCGAGGGCGTCCTGGGGG - Intergenic
1025186586 7:56865104-56865126 GGAGGCAGAGGGTGTGATTGGGG - Intergenic
1025685336 7:63711808-63711830 GGAGGCAGAGGGTGTGATTGGGG + Intergenic
1034163066 7:149006557-149006579 TGAGCCCAAGGGTTTCCGTGGGG + Intronic
1035259958 7:157654644-157654666 GGAGGCTGAGTCTGTCCTTGCGG + Intronic
1035297901 7:157877284-157877306 GCAGCACCAGGGTTTCCTTGGGG + Intronic
1035581139 8:739404-739426 GTAGCCCGAGGGAGTCCAGGAGG + Intergenic
1036549878 8:9806438-9806460 GGAGCAGGAGGGTGTCCTGTTGG - Intergenic
1036580017 8:10065204-10065226 AGAGCCCCAGGGTGTCCAGGTGG + Intronic
1037700707 8:21271686-21271708 GGAGCCCCAGAGTGTTCTGGAGG + Intergenic
1037872189 8:22509020-22509042 GGAGCCTGTGGGTTTCTTTGAGG - Intronic
1038461172 8:27718286-27718308 GCAACCCGAGGATGTCTTTGAGG + Intergenic
1038522140 8:28242999-28243021 GGAGCCAGAGGCTGACCATGTGG - Intergenic
1040579779 8:48688358-48688380 GCAGCAGGAGGGTGTCCTGGCGG - Intergenic
1044753305 8:95436804-95436826 ACAGCACGAGGGTGTCTTTGGGG - Intergenic
1049364938 8:142232574-142232596 GGAGCCCGAGGGAGCACCTGCGG + Intronic
1049522764 8:143102755-143102777 AGAGCCCAAGGGGCTCCTTGGGG - Intergenic
1049742448 8:144247613-144247635 GGTGCACGAGGCCGTCCTTGAGG - Exonic
1050077020 9:1876007-1876029 GGAGGCCGAGGGTGAACTTTGGG + Intergenic
1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG + Intronic
1057270322 9:93646746-93646768 GTAGCCCCAGGGTGGCCATGTGG - Intronic
1057916077 9:99056287-99056309 GGAGCACCTGGGGGTCCTTGGGG - Exonic
1059224929 9:112663155-112663177 GGACCCATAGGGTGTCCTTCAGG + Exonic
1060522159 9:124300107-124300129 GGAGCCTCAGGGTGCCTTTGAGG + Intronic
1061610344 9:131741235-131741257 TGAGCCCCAGGGTGCCCTTCTGG - Intergenic
1062181111 9:135191779-135191801 AGTGCCCGAGGGTGACCTGGGGG + Intergenic
1062269579 9:135702422-135702444 GGAGCCTGAGGGGGAACTTGGGG - Intronic
1185461371 X:334119-334141 AGCGCCAGAGGGTGTCCGTGTGG + Exonic
1185988351 X:4862657-4862679 GGAGGCCGAGGCAGGCCTTGAGG + Intergenic
1188894911 X:35654949-35654971 GGAGGCCCATGGAGTCCTTGGGG + Intergenic
1191899176 X:66023191-66023213 GGATCCCCAGAGAGTCCTTGTGG + Intronic
1195278947 X:103310832-103310854 GGACCCGGAGGGGGTCCCTGGGG - Exonic
1197666555 X:129230162-129230184 GAAGCCTGAGGGTGTTGTTGTGG - Intergenic