ID: 1138651971

View in Genome Browser
Species Human (GRCh38)
Location 16:58465787-58465809
Sequence GGAAAGGTGGAAGCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138651971 Original CRISPR GGAAAGGTGGAAGCTGTTCC TGG Intronic
901278921 1:8016377-8016399 GGGAGGGAGGAAGCTGTCCCAGG - Intronic
901567173 1:10127064-10127086 GGATAGGTGGAAGATGTACCAGG - Intronic
902195860 1:14797425-14797447 GGGAACCTGGAAGCCGTTCCAGG + Intronic
902701002 1:18171958-18171980 GGAAAGGTTGAAGAGGTACCTGG + Intronic
903165027 1:21514314-21514336 GGTAAGGTGGAAGCTGTCAAGGG - Intronic
904232968 1:29092390-29092412 AGAAAGGAAGAAGGTGTTCCTGG - Intronic
904838610 1:33355637-33355659 GGAAAGGTTGTAGCTGTTGCAGG - Intronic
905997463 1:42393681-42393703 GGAAAGGTGGAAACTGATGGAGG + Intronic
907858225 1:58324911-58324933 GGAATGGTGGCATCTGTGCCGGG - Intronic
908683697 1:66690992-66691014 GGAAAGGGGGATGATGCTCCAGG - Intronic
909130937 1:71736580-71736602 TGAAAGGTGGCAGCTTTTGCTGG - Intronic
909836436 1:80260771-80260793 GGAAGGGTGGCTGCTGATCCAGG - Intergenic
910327569 1:86027791-86027813 TGAATGGTGCAAGCTGTTCGTGG - Intronic
910514882 1:88049031-88049053 GTAAAGGTGGAAGATATTTCTGG - Intergenic
910839188 1:91545723-91545745 GGAAAGTGGGAAGGCGTTCCAGG - Intergenic
915557491 1:156668654-156668676 GGAGAGGAGGAAGCTGGTGCTGG - Intergenic
916723329 1:167501770-167501792 GCAAAGGTGGCAGCTGTGGCTGG - Intronic
917517360 1:175719203-175719225 GAAGAGGTGGCAGCTGTCCCCGG + Intronic
919393538 1:197016999-197017021 GGAAGGAAGGAAGCTCTTCCTGG - Intergenic
919576037 1:199310978-199311000 GGAAAGGTGTGGGCAGTTCCTGG - Intergenic
919972116 1:202587803-202587825 GGCAAGCGGGAATCTGTTCCGGG - Exonic
920701730 1:208223077-208223099 GGGAAGTTAGCAGCTGTTCCTGG + Intronic
921260204 1:213379484-213379506 GCTAAGGCGGAATCTGTTCCAGG - Intergenic
921269353 1:213453368-213453390 GGAGAGGAGCAGGCTGTTCCAGG + Intergenic
922880814 1:228979210-228979232 GGAAAGGCGGAAGCTCTGCTAGG - Intergenic
923149114 1:231218009-231218031 GGAGAGCTGGATGCTGTCCCTGG - Intronic
923669430 1:236027491-236027513 GGAAAGGTTGAAGCAATTACTGG - Intronic
924466854 1:244305890-244305912 GCAAAGGGGCAAGCTGTGCCGGG - Intergenic
1064242101 10:13640158-13640180 TAAAATGTGGAAGCTTTTCCAGG - Intronic
1065480019 10:26183651-26183673 GTAGAGGTGGAAGCTATCCCTGG + Intronic
1067750063 10:48965622-48965644 GAAGAGGTGGAAGCTGGTCCAGG - Intronic
1068827958 10:61460957-61460979 GGAAAGGGGGAAGGGATTCCAGG + Intergenic
1069489391 10:68848370-68848392 GGAAAGGTGAAAGGTCTTGCAGG - Intronic
1069727500 10:70590426-70590448 GGAAAGGTGCAGGCAATTCCTGG + Intergenic
1069802933 10:71093528-71093550 GGAAAGTTGGAACTTTTTCCAGG - Intergenic
1071103651 10:82068699-82068721 GGAAAGGGGGAGAGTGTTCCAGG + Intronic
1073006531 10:100329554-100329576 GGAAAGGAGGCACCTGTTCCAGG + Intronic
1074299272 10:112218734-112218756 GGAAAGGTGTGAGGAGTTCCCGG + Intergenic
1074531565 10:114302052-114302074 GGAAAGGTGACAGCTCTGCCTGG + Intronic
1075969820 10:126642931-126642953 GGAAAAGTTAAAGATGTTCCTGG - Intronic
1077287184 11:1772904-1772926 GGAAAGGTGGAGGCTGTGAATGG + Intergenic
1078334908 11:10455701-10455723 GGAAAGGTGGAAGCAGTTCATGG + Intronic
1081126191 11:39325687-39325709 CGAAACATGCAAGCTGTTCCAGG - Intergenic
1083608615 11:63994142-63994164 AGAAAAGTGGAAGCTGTCCCAGG + Intronic
1084491499 11:69481102-69481124 GGAAGGAGGGAAGCTGGTCCTGG - Intergenic
1084524032 11:69684850-69684872 GGAAAGGAGGAAGCTCCCCCAGG - Intergenic
1085732946 11:79014634-79014656 AGAGAGGAGGCAGCTGTTCCAGG + Intronic
1085877065 11:80421158-80421180 GGAGAGGTTGAAACTTTTCCAGG + Intergenic
1089630348 11:119780342-119780364 GGAAAGCTGGAAACTTTTCCAGG + Intergenic
1095108973 12:38270355-38270377 GCAAAGAAGGATGCTGTTCCAGG - Intergenic
1096768957 12:53920294-53920316 GCAAATGTGGGAGCTGATCCTGG - Intergenic
1097113149 12:56677290-56677312 ACAAAGGTGAAAGCTGTTCAAGG - Intronic
1097922708 12:65093762-65093784 GGATAGGTGGATTCGGTTCCCGG + Intronic
1098073400 12:66700182-66700204 GAAAAGGGGAAAGATGTTCCAGG + Intronic
1098894132 12:76038235-76038257 GGAAAGGTGGTAGGTGTTCTTGG - Exonic
1100688893 12:97017629-97017651 GCAAAGGTGGAAGGTGATGCAGG + Intergenic
1103999590 12:124852087-124852109 GGAAGCGTGGAGGCTGTTTCTGG - Intronic
1104091945 12:125524986-125525008 GGAAAGAAGGAAGGTGTTCTAGG + Intronic
1104233460 12:126908138-126908160 GGAAAGGTGTGGGCAGTTCCTGG + Intergenic
1104731478 12:131107691-131107713 GGAAAAGGGGCAGCTGGTCCTGG + Intronic
1105509353 13:21038206-21038228 GCAAAGGTGGAGCCTGTACCGGG + Intronic
1106103068 13:26710790-26710812 GGGAAGGTGCAAGGTGTTCTGGG - Intergenic
1107980225 13:45728055-45728077 GGAATGGAGGAGGCTTTTCCAGG + Intergenic
1108651738 13:52487616-52487638 GGACAACTGGAAGCTGCTCCTGG + Intergenic
1108778637 13:53799269-53799291 GGGAAGATGCAAGCAGTTCCTGG + Intergenic
1110034552 13:70665789-70665811 TGAAAAGTTCAAGCTGTTCCTGG + Intergenic
1112189598 13:97163406-97163428 GACAGGGTGGAAGCTGGTCCAGG + Intergenic
1112247226 13:97746228-97746250 GGGAAGGAAGAATCTGTTCCAGG - Intergenic
1113381494 13:109810015-109810037 GGACAGGAGGAGGCAGTTCCTGG + Intergenic
1114292765 14:21302236-21302258 AGAAAGGTGGAAGCTTGTCCAGG - Intronic
1114689443 14:24566606-24566628 GGGAAGGTGGAACCTTTTACAGG - Intergenic
1115362962 14:32524314-32524336 GGACAGGCGGAAGCAGTTCTGGG + Intronic
1115897252 14:38104439-38104461 AGAAAGGTGGAACTGGTTCCAGG - Intergenic
1116790827 14:49338214-49338236 GGTAAGGGAGAAGCTGTTCATGG - Intergenic
1116972113 14:51076887-51076909 GGAAAACTAGAATCTGTTCCAGG - Intronic
1119263815 14:73252912-73252934 GGAGAGGTGGCAGCTCTTCCTGG + Intronic
1121843630 14:97154900-97154922 GGGAAGGGGGAAGCTGGCCCAGG + Intergenic
1122980577 14:105190784-105190806 GGAAAGGTGGAAGGTCCCCCAGG + Intergenic
1124862766 15:33459085-33459107 GGAAGGGTGGATGCTGGGCCGGG - Intronic
1125643257 15:41249157-41249179 AAGAAGGTGGAAGCTGTTCCAGG - Intronic
1127328701 15:57918666-57918688 AGAAAGGAGGGACCTGTTCCAGG - Intergenic
1128452415 15:67813395-67813417 GGACAGGAGGAAGGTGTCCCAGG - Intergenic
1128781124 15:70359356-70359378 GGGAAGGTGGAACCTGAGCCAGG + Intergenic
1129937929 15:79466154-79466176 GGAAGGGTGGGAGGTGGTCCTGG - Intronic
1130114944 15:80998709-80998731 AGAAAGGTGGAGGCAGTGCCTGG + Intergenic
1130962590 15:88672949-88672971 AGAAAGGTGTAAGATATTCCCGG + Intergenic
1132603871 16:785641-785663 TGAGAGCCGGAAGCTGTTCCAGG + Exonic
1132886390 16:2184129-2184151 GGAAGGGTGGAGGATGCTCCAGG - Intronic
1133738413 16:8633007-8633029 GGCAAGGAGGAAGCTTTCCCAGG + Intronic
1134011245 16:10854741-10854763 GTAAAGGTGGAAGATGATTCCGG + Intergenic
1135100584 16:19601723-19601745 GGTAATGTCGCAGCTGTTCCTGG + Exonic
1135592841 16:23717051-23717073 GGACAGGGAGAAGCTGTTCCAGG + Intergenic
1136169906 16:28482625-28482647 GGAAAGGTGGACAGTGTTCAAGG - Exonic
1138167567 16:54817495-54817517 GGAATGCTGGAGGCTGGTCCCGG + Intergenic
1138235643 16:55380163-55380185 GGAAGGGTTGAGGCTGTTGCTGG - Intergenic
1138651971 16:58465787-58465809 GGAAAGGTGGAAGCTGTTCCTGG + Intronic
1140616637 16:76672320-76672342 GGAAAAGTGGAAGCTAAGCCTGG + Intergenic
1140793635 16:78415165-78415187 GGAAAGGGGTAGGCAGTTCCCGG + Intronic
1141586448 16:85036770-85036792 GGAAAGGCGGGAGCTGTCCCCGG - Intronic
1141634937 16:85309622-85309644 GGCACTGTGGAAGCTGCTCCCGG - Intergenic
1142438034 16:90075715-90075737 GGAATGGGGGCAGCTGGTCCTGG - Intronic
1146961740 17:36986124-36986146 GGCAAGGTGGAAGGTGTTGGTGG + Intronic
1148867773 17:50637899-50637921 GGGGAGCTGGGAGCTGTTCCTGG + Intronic
1158935036 18:62356677-62356699 GGAAAGGTGGGAACTGTGCTGGG + Intronic
1160690363 19:458546-458568 GGGGAGGTGGAAGCGGGTCCTGG + Intronic
1161093524 19:2375612-2375634 GGAAGGGTGGAAGCTGTGATTGG + Intergenic
1161723519 19:5916074-5916096 GGGGAGGTGGAGGCCGTTCCTGG + Exonic
1161979339 19:7622462-7622484 GGAAAGGTTGGAGCTGGTTCTGG + Intronic
1162143453 19:8598456-8598478 GGAAAGGAGGAAGCAGCCCCAGG + Intronic
1165803933 19:38568867-38568889 GGAGAGATGGAAGATGTTCCTGG + Intronic
1166076956 19:40419362-40419384 TGAAAGGTGGCAGTTGTGCCAGG + Intergenic
1166405496 19:42519065-42519087 GGAGAGGATGAAGCTGTCCCAGG - Exonic
1168346905 19:55654382-55654404 GAAAAAGTCGAAGCTGTCCCCGG + Intronic
925503708 2:4536207-4536229 GGAGAGGAAGAATCTGTTCCAGG - Intergenic
926781858 2:16480290-16480312 GGCCAGGTGGAAGCTCTCCCAGG - Intergenic
928114951 2:28539919-28539941 GGATAGAGGGAAGCTTTTCCTGG - Intronic
928115030 2:28540147-28540169 GGATGGAGGGAAGCTGTTCCTGG - Intronic
929113805 2:38427627-38427649 GAAAAGGTGGAAACTATTCTTGG + Intergenic
929537046 2:42790259-42790281 GGAAAGGTGGATGAGGTTGCAGG + Intronic
931703102 2:64924724-64924746 TGAGAGGTGGAAGCTATTCATGG + Intergenic
933256841 2:80090671-80090693 GAAAAGGTGGAAGCCTTTTCAGG + Intronic
934930580 2:98419296-98419318 GGAAAGATGGAAGCATTTCTTGG - Intergenic
935026187 2:99279149-99279171 TGAAAGTTGGAAGCTGTCTCTGG + Intronic
936271446 2:111052471-111052493 GCAGAGGTGGAAGCTGTTACTGG + Intronic
937330215 2:121021944-121021966 GGAAAGCTGCACGCTGTGCCTGG + Intergenic
937504814 2:122525273-122525295 GGAAAGTTGGAAGCTATGCCTGG - Intergenic
937695721 2:124806330-124806352 GGAAAGGGGGTAGCTCTTCCTGG + Intronic
937989487 2:127654356-127654378 GGAGAGGTGGCAGGTGTGCCAGG + Intronic
942248851 2:174031124-174031146 GGAAAGGGGGAAGGCGTTTCAGG - Intergenic
943778114 2:191790102-191790124 GGAAAGGTGGATTCTTTTCAGGG - Intergenic
945030356 2:205657444-205657466 GGAAGGGTGCAACCTGTTTCTGG - Intergenic
945777448 2:214124851-214124873 GGCAAGGTGAAAGGTGCTCCAGG - Intronic
945945835 2:215994790-215994812 AGAAAGGTGGGAGCTCCTCCAGG + Intronic
946498051 2:220216042-220216064 GGTTAAGTGGCAGCTGTTCCTGG + Intergenic
947618441 2:231573748-231573770 GGGAGGGTGGATGCTGTTACAGG - Intergenic
947874187 2:233457658-233457680 GGAGAGGGGGAGGCTGTTCCAGG + Intronic
948509242 2:238452283-238452305 GGAGAGGTGGCAGAGGTTCCGGG - Intergenic
1168836548 20:881485-881507 GGAGAAGGGGAAGGTGTTCCAGG + Intronic
1170519021 20:17163803-17163825 GGCAAGGTGGCTTCTGTTCCTGG - Intergenic
1171088681 20:22263512-22263534 GGGAAGGTGAGAGCTGTTCTGGG - Intergenic
1172342978 20:34173367-34173389 GGGAAAATGTAAGCTGTTCCTGG - Intergenic
1172535371 20:35668917-35668939 GGAAAAGTGGAAGCTGTACTTGG - Exonic
1172669804 20:36627175-36627197 GGAACAGTGGAAGCTGTGGCTGG + Intronic
1173338770 20:42135679-42135701 TGAAAAGTGTAAGATGTTCCAGG + Intronic
1173746662 20:45442664-45442686 GGAAAGGGGTCAGCAGTTCCTGG + Intergenic
1174604110 20:51748047-51748069 GGAGAGGAGGAAGCAGTTCTGGG + Intronic
1175953612 20:62596731-62596753 AGAAGGGTGGCAGCTGTCCCCGG - Intergenic
1177056925 21:16317859-16317881 GGAAAGCTGGAAGCTCTTATTGG + Intergenic
1178161466 21:29921132-29921154 GGAGTGGTGGAAGCTGCTACTGG - Intronic
1179123397 21:38569388-38569410 GGAAAGGTGGGAGCTACTGCTGG - Intronic
1179251244 21:39673403-39673425 GGCAAGGTGGGGGCTGTCCCTGG + Intergenic
1179997611 21:44981219-44981241 AGGAAAGTGGAAGCTGTTCCAGG + Intergenic
1180073207 21:45449033-45449055 GCAGAGGTGGCAGCTGTCCCTGG + Intronic
1181451380 22:23024390-23024412 GGAAAGGTGGAGGGGCTTCCAGG - Intergenic
1181886172 22:26023985-26024007 GGAAAGGAGGGAGCTGCTCTGGG + Intronic
1181915252 22:26274715-26274737 GGAAAGCTGGAAGCTGTGCCTGG - Intronic
1182034723 22:27188883-27188905 GGTGAGGTGGAGTCTGTTCCTGG - Intergenic
1182080920 22:27528128-27528150 GGAGAGGTGGAGGCACTTCCTGG - Intergenic
1183898883 22:40990546-40990568 GGGAGGGTGGAAGCTGTGCCTGG + Intergenic
1184261767 22:43321424-43321446 TGCAAGGTAGAAGCTGTTGCAGG + Intronic
1184917249 22:47578382-47578404 GGGAAGCTGGGAGCTGTTCAGGG + Intergenic
950515076 3:13459908-13459930 GGAAGGGTAGAAACTGCTCCAGG + Intergenic
951466300 3:23003901-23003923 GGCAAGGTGGATGGTGTTACTGG + Intergenic
952336966 3:32411928-32411950 GGAAAGGTGGAAGGGTGTCCTGG + Intronic
952585361 3:34886205-34886227 GGAAATGAGGAAGGTGTTACTGG + Intergenic
953118765 3:40018689-40018711 GGAAAGGTAGAAGCTGTGAGAGG - Intronic
953637291 3:44674020-44674042 GGAAAGAAGGACGCTGTTCTAGG - Intergenic
955057133 3:55464928-55464950 GGAGAGGTGGCATCTATTCCAGG - Intergenic
961175264 3:124830233-124830255 AGAAGGATGGAAGCTGTTCTTGG - Intronic
962918789 3:139933434-139933456 GGAAAGGTGGTAGCTGACCCAGG - Intergenic
966870208 3:184285355-184285377 GCATATGTGGAAGCTGTCCCGGG - Intronic
967414160 3:189198210-189198232 GGGTAGGTGGAGGATGTTCCAGG - Intronic
969052099 4:4380272-4380294 GGAGAGGTGGAGCCTGTCCCTGG - Intronic
969445043 4:7239898-7239920 GGGAAGGTGGACGTTGTTCCTGG + Intronic
970194757 4:13542995-13543017 GGGAAGGTGGAGGCGGATCCTGG + Intronic
970776973 4:19686374-19686396 GCAAAGGTGGAAGCTCTGTCTGG + Intergenic
971744082 4:30556815-30556837 GACAAGGTGGTAGCTGATCCTGG - Intergenic
972554983 4:40172590-40172612 GCAAGGGAGGCAGCTGTTCCAGG - Intergenic
975624632 4:76332828-76332850 GGAGTGGTGGAAGCTGATCAGGG + Intronic
975769283 4:77703844-77703866 AAAAAAGTGGAAGATGTTCCAGG + Intergenic
979087074 4:116426980-116427002 GGAAAGGAAGAAGGTGTTACAGG - Intergenic
980779707 4:137480137-137480159 TGAAAGGTGAAGGGTGTTCCAGG + Intergenic
980962388 4:139488497-139488519 AGAAAGGTGAAAGCGGTTTCTGG - Intergenic
981599464 4:146469289-146469311 GGAGAGGTAGAAGCTATTGCTGG + Intronic
983818069 4:172156811-172156833 GGAAGGATGGAAGCTTTTCTAGG + Intronic
983876139 4:172876576-172876598 GCAAAGATAGAAGCTGTTCCTGG - Intronic
984990380 4:185374831-185374853 ATAAATGTGAAAGCTGTTCCTGG - Intronic
987503882 5:18745781-18745803 GGAAAGGTGGAACTGGCTCCAGG + Intergenic
987863060 5:23509207-23509229 GGAATGGGGGCAGCTGGTCCTGG + Intronic
990810535 5:59717252-59717274 GGAATGGTGGCAGCTTTTCCAGG - Intronic
991609154 5:68433054-68433076 GGCAAAGTGGAAGCAGATCCTGG - Intergenic
995478637 5:112573143-112573165 GGGAAGGTAAAAGCTGTTCCTGG - Intergenic
996310170 5:122095589-122095611 GGGAATCTGGAAGCTGTCCCTGG - Intergenic
997675134 5:135707125-135707147 GGTAGGGTGGAAGCTGTCCAGGG + Intergenic
998934796 5:147223591-147223613 GAAAAGTTGGAAACTGTTACTGG - Intergenic
1001258506 5:170204551-170204573 GGACATGTGAAAGCTCTTCCCGG - Intergenic
1001412256 5:171519946-171519968 GGAAGGCTGGAAGCTGGGCCAGG + Intergenic
1001612616 5:173015617-173015639 GGAAAGCTGGAAGCTATTCCTGG + Intronic
1002289332 5:178188891-178188913 GGAAGGTGGGAGGCTGTTCCAGG + Intergenic
1003508431 6:6759241-6759263 GGAGAGGAGGATGCTGTGCCTGG - Intergenic
1006114350 6:31767340-31767362 GGTAAGGAGGGAGGTGTTCCTGG - Exonic
1006367439 6:33623751-33623773 GGACTGGAGGAAGCAGTTCCTGG - Intronic
1006968250 6:38012344-38012366 AGAAAGGAGGAAGCTCTTCAGGG - Intronic
1006982298 6:38156341-38156363 GGAATGATGGAAGCCCTTCCTGG + Intergenic
1007219331 6:40265983-40266005 GGAAAGGTGAGAGCTGCTCTTGG + Intergenic
1008440005 6:51521740-51521762 GGAGTGGTAGAAGCTTTTCCTGG + Intergenic
1009192308 6:60644051-60644073 GGCAAGGTGCAAGCAGTTACAGG + Intergenic
1012414159 6:98994319-98994341 GAAGAGGTGGAACATGTTCCTGG - Intergenic
1013870915 6:114758474-114758496 TTAAAAGTGGAAGCTTTTCCTGG - Intergenic
1014560703 6:122886722-122886744 GGAAAAGTGGAAGCAGTTAAGGG - Intergenic
1015040528 6:128712395-128712417 AGAAAGGTGAAAGCTGTTGATGG + Intergenic
1015100199 6:129468961-129468983 GGAGGGGTGGAAGCAGTTGCAGG + Intronic
1016497688 6:144682995-144683017 GCAAAGGGGGAAGCTGTTTTGGG - Intronic
1017145308 6:151229472-151229494 GGAAAGGTGTGGGCAGTTCCAGG - Intergenic
1017504857 6:155059017-155059039 GGAAAGGGAGAAGATGTTTCAGG + Intronic
1018401478 6:163425198-163425220 GGGAAGGTGGAGGATGTTCCAGG + Intronic
1019167316 6:170107272-170107294 GGAGAGGTGGAAGCTGCTGACGG - Intergenic
1020133170 7:5570735-5570757 GGAAAGGGAGAAGCTGTGGCTGG + Intergenic
1020956156 7:14741621-14741643 AGAAAGCTAGAAGCTGTTCATGG - Intronic
1021820585 7:24494219-24494241 GGCAAGATGGAAACTGCTCCTGG + Intergenic
1021851646 7:24814404-24814426 AGAAAGATGGAAGCTGTTGGGGG + Intronic
1022377694 7:29829731-29829753 GGAAAGGTGGAAGCGGAACCTGG + Intronic
1023091970 7:36625668-36625690 GGGAAGGTGGAAGATTGTCCAGG + Intronic
1023445654 7:40229043-40229065 GGAAAGGTACAAAATGTTCCTGG - Intronic
1023537183 7:41225814-41225836 GGAAAGGTGGAGGCTTCTACTGG + Intergenic
1023793572 7:43772469-43772491 GGCAGGGGGGAAGCTGCTCCAGG - Intronic
1024658709 7:51473541-51473563 GGGCTGGTGGAAGCTGTCCCTGG + Intergenic
1027991838 7:85372663-85372685 GGAATGGGTGAAGCTATTCCAGG + Intergenic
1028344352 7:89761336-89761358 GGAAGGGGTGAAGCTGTGCCAGG - Intergenic
1029619168 7:101679218-101679240 GGAAAGGTGGGAGAAGTTGCGGG + Intergenic
1030084264 7:105803531-105803553 GTAAAGGTGGAAGGTGTTCTAGG - Intronic
1030851831 7:114497232-114497254 GGAAAGATGAAAGCTGTTATTGG - Intronic
1031982586 7:128137140-128137162 GGAAAGGAGGCAGCTGGGCCTGG + Intergenic
1034424882 7:151009202-151009224 GCACAGGCGGAAGATGTTCCAGG + Exonic
1036477105 8:9103315-9103337 GGTGAGGTGGAAGCTTCTCCTGG - Intronic
1037380974 8:18284751-18284773 GGAAAGGTGGGAGCTGTGGCAGG - Intergenic
1037865833 8:22441414-22441436 GGAGAGGTGGAAGCGCCTCCCGG - Exonic
1038734447 8:30156447-30156469 GTAGGGGTGGAACCTGTTCCTGG + Intronic
1040560482 8:48519484-48519506 GGAAAAATGTAACCTGTTCCAGG + Intergenic
1040561623 8:48527875-48527897 GGAAAGGTGGAAGGTTTTGAGGG - Intergenic
1041207287 8:55511631-55511653 GGCGAAGTCGAAGCTGTTCCAGG - Intronic
1041539543 8:58967462-58967484 GGAACAGTGTCAGCTGTTCCTGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050074687 9:1851508-1851530 GGAGAGAGGGAAGCAGTTCCAGG - Intergenic
1052049042 9:23824656-23824678 GGAAAGGGGGAGGATGTTCGTGG - Intronic
1052961148 9:34298105-34298127 GGAAGGGGGGAAGGTATTCCAGG + Intronic
1053381739 9:37654663-37654685 GAGAAGGAGGAAACTGTTCCAGG + Intronic
1055771802 9:79724895-79724917 GGAAAGGTGAAAGGTGGTCATGG - Intronic
1057354113 9:94321074-94321096 GGAATGTGGGAAGCTGTACCTGG + Exonic
1057354593 9:94323127-94323149 GGAATGTGGGAAGCTGTGCCTGG - Intronic
1057568322 9:96184444-96184466 AGGAAGGTGGAAGGTGTTCCAGG + Intergenic
1057653164 9:96934508-96934530 GGAATGTGGGAAGCTGTGCCTGG + Intronic
1057653653 9:96936561-96936583 GGAATGTGGGAAGCTGTACCTGG - Exonic
1058082309 9:100712953-100712975 GGAAAGTTGGACGCTGTTAAAGG - Intergenic
1060155877 9:121319319-121319341 GGAAAGGAGGGAGCTATCCCAGG + Intronic
1060816503 9:126638104-126638126 GGAGAGGGGGCAGCAGTTCCAGG + Intronic
1061043807 9:128153799-128153821 GCACAGCTGGAGGCTGTTCCAGG + Intergenic
1185877321 X:3712120-3712142 GGAAAGGAGGAAGCTGGGCTGGG - Intronic
1185955523 X:4484734-4484756 GGAAAGGGGTAGGCAGTTCCAGG - Intergenic
1186123284 X:6385463-6385485 GGAAAGGGGTGGGCTGTTCCTGG + Intergenic
1186479189 X:9883214-9883236 GGAAGGGTGGAAGTTGATCCAGG + Intronic
1188387124 X:29575127-29575149 GAAAAGGTGGAAGCAGCTTCGGG - Intronic
1189301074 X:39952792-39952814 GTAAAGGTGGCAGCGCTTCCTGG - Intergenic
1190382818 X:49855957-49855979 GGTAATGTGGAAACTGGTCCTGG - Intergenic
1191594968 X:62933785-62933807 GGGAAGATAGAAGCTGTTCATGG + Intergenic
1192338303 X:70240021-70240043 GGGAAGGTGGGAGCTGATCTGGG + Intronic
1193198366 X:78659384-78659406 GGAAAGTTGGAATGTGTTCTGGG - Intergenic
1194051833 X:89078877-89078899 GGAAAGCTAGAAGTTGTTCTTGG + Intergenic
1197040457 X:121930116-121930138 TGAAAGGTGAAAGCTGTTGGTGG - Intergenic
1198208190 X:134489117-134489139 GAAAAGGTGGAAGCTTTACTTGG + Intronic
1199801896 X:151259988-151260010 TGTGAGGTGGAATCTGTTCCAGG + Intergenic
1200787978 Y:7275411-7275433 GGAAAGGAGGAAGCTGGGCTGGG + Intergenic
1202074978 Y:21028342-21028364 GGAAAAGTGGAAGCAGGTTCTGG + Intergenic