ID: 1138652167

View in Genome Browser
Species Human (GRCh38)
Location 16:58466823-58466845
Sequence TGGCCCCTGTCTCTAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138652164_1138652167 3 Left 1138652164 16:58466797-58466819 CCCTCTCATCTTAAAGATGGAAC 0: 1
1: 0
2: 4
3: 18
4: 203
Right 1138652167 16:58466823-58466845 TGGCCCCTGTCTCTAAGAGATGG 0: 1
1: 0
2: 0
3: 12
4: 166
1138652162_1138652167 18 Left 1138652162 16:58466782-58466804 CCTCTCAGACTTCAGCCCTCTCA 0: 1
1: 0
2: 3
3: 31
4: 339
Right 1138652167 16:58466823-58466845 TGGCCCCTGTCTCTAAGAGATGG 0: 1
1: 0
2: 0
3: 12
4: 166
1138652165_1138652167 2 Left 1138652165 16:58466798-58466820 CCTCTCATCTTAAAGATGGAACT 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1138652167 16:58466823-58466845 TGGCCCCTGTCTCTAAGAGATGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138652167 Original CRISPR TGGCCCCTGTCTCTAAGAGA TGG Intronic
900358413 1:2275839-2275861 TGGCCCCTGGCTCTTTGGGAGGG + Intronic
900496879 1:2979740-2979762 TGGCTCCTGTCTCCAGGAGGAGG + Intergenic
902088599 1:13883903-13883925 GAGCCCCAGTCTCCAAGAGAAGG + Intergenic
902860414 1:19241131-19241153 TGGATGCTGTCACTAAGAGAGGG + Exonic
903668166 1:25020724-25020746 TGGCCCCTGGCGCTAGGAGCAGG + Intergenic
908329105 1:63052834-63052856 TGGCCCCTGTCTTACAGATAAGG + Intergenic
911675611 1:100655245-100655267 TGGCACCATTCTCTAAGAGCAGG + Intergenic
914858057 1:151366378-151366400 CAGACCCTGTCTCTAAAAGATGG - Exonic
915555049 1:156656719-156656741 TGGTTCCTGTCTCTTAGAAAAGG + Intronic
919584750 1:199422457-199422479 AGCCACCTGTCTCTAAGAGTGGG + Intergenic
920872414 1:209805583-209805605 TGGCCCCTGTGTCCCAGAGAGGG - Intronic
921235544 1:213123978-213124000 TGGGGCCTGTCTTTCAGAGATGG + Intronic
921672384 1:217940271-217940293 TGGCCCCTTTCCCTAATAAAGGG + Intergenic
922352748 1:224747765-224747787 TGCCCCGGGTGTCTAAGAGATGG + Intergenic
1063026239 10:2181584-2181606 AGGCCTCTGTGTCTAAGAGATGG - Intergenic
1063085473 10:2814010-2814032 TTTCCCCTATCTCTGAGAGAAGG - Intergenic
1063728034 10:8661181-8661203 TGGACTCTATCTCTTAGAGAGGG + Intergenic
1064206696 10:13330432-13330454 TGCCTTCTGTCTCTAAGACAGGG - Intronic
1064746795 10:18486638-18486660 TGGACCCTGTCATTAACAGATGG - Intronic
1067656309 10:48194586-48194608 AGTCCCCTGCCTCTAAGGGATGG - Intronic
1070714803 10:78711676-78711698 CTGCCCCTGTCTCTAACACAGGG + Intergenic
1071105317 10:82087001-82087023 AGTCCTCTGTCTATAAGAGAGGG + Intronic
1073332786 10:102681600-102681622 TGGCTCCTGTCTCCAGGAGGAGG + Intronic
1076769147 10:132653575-132653597 TTGCCCCTGCCTCTGAGAGATGG + Intronic
1078466780 11:11555826-11555848 TGGACTCTGTCTCAAAGACATGG + Intronic
1082883153 11:58058178-58058200 TGGTCCCTCTCTCTCAGAGCAGG + Intronic
1083032170 11:59602991-59603013 TATCCCCTGTTTCTAAGAAAGGG + Intronic
1083544717 11:63539576-63539598 TGGGCCCTGTATATAGGAGATGG + Exonic
1084934710 11:72580727-72580749 TTGCCCCTGGCTCTGAGATAGGG - Intronic
1085057442 11:73414050-73414072 AGGACCCTGTCTCTTAAAGAAGG + Intronic
1085082315 11:73645473-73645495 TGGCCCATGTCTCTAAAAGCTGG - Intergenic
1085543899 11:77299127-77299149 CGGCCCCTGTCTCATAAAGAGGG - Intronic
1085654118 11:78296881-78296903 AGGGCCCTGTTTCTAACAGATGG + Intronic
1088626325 11:111733038-111733060 TGGCCCCTGTGTCTGAGGGAGGG - Intronic
1089021469 11:115219724-115219746 TGGCCTCTGTCTCTGAAAGGGGG - Intronic
1089821157 11:121227320-121227342 TTGCTCCTGTGTCTGAGAGAAGG + Intergenic
1090485254 11:127107039-127107061 TGGCCCCTGTGTCCAAGAACAGG - Intergenic
1091337436 11:134782874-134782896 TGGGACCTGTCTTTGAGAGATGG - Intergenic
1091478889 12:806406-806428 TGGCCCCAGTCTCCAAGGAAGGG - Intronic
1099647727 12:85380639-85380661 TGGTCCCTATCTCTGAGAGCTGG - Intergenic
1101488587 12:105191404-105191426 TTGATCCTGTCTTTAAGAGAGGG + Intronic
1103792048 12:123478798-123478820 TGGTCCCTGTCTCTCAGTCATGG - Intronic
1105702046 13:22941017-22941039 TGGCCACTGTCTCGAACAAAAGG + Intergenic
1106062494 13:26308370-26308392 TTGACCCTTTCTCTAATAGAGGG + Intronic
1114455987 14:22853756-22853778 TGTCCCCTTTATCTAAGAGTGGG + Intergenic
1114522621 14:23348559-23348581 TGGCCCTTGTCTCTAAGGATTGG - Exonic
1118827726 14:69398941-69398963 GCGCCCCTGTCTCCAAGAGGCGG - Exonic
1118890148 14:69902401-69902423 TGGCTCCTTTCATTAAGAGATGG + Intronic
1119796958 14:77407363-77407385 TAGCCCCTATCTCTTAGAGTTGG - Intronic
1120844373 14:89113030-89113052 TGGCCCCTGCCCCTAACACAAGG + Intergenic
1122670900 14:103371338-103371360 TAGACCCTGTCTCTAAAAAAAGG + Intergenic
1122911306 14:104829173-104829195 TGGCCCCTTCCTCTATGTGAGGG + Intergenic
1123510120 15:20990006-20990028 TGGCCCATTTGTCTAACAGATGG + Intergenic
1123567335 15:21563758-21563780 TGGCCCATTTGTCTAACAGATGG + Intergenic
1123603599 15:22001052-22001074 TGGCCCATTTGTCTAACAGATGG + Intergenic
1128229935 15:66027395-66027417 AGGCCCCTGTCTGTGAGGGATGG - Intronic
1128660039 15:69493420-69493442 AGGCCTCTGTCTCAGAGAGAGGG + Intergenic
1129050408 15:72776942-72776964 TGGCCCTTCTCTTTAAAAGAGGG + Intronic
1130144596 15:81264238-81264260 TGGTCCCTGTAACTCAGAGAGGG + Intronic
1130424520 15:83782177-83782199 TGACCCCAGTCTTTAAGTGATGG - Intronic
1131675193 15:94663999-94664021 TGGACCCTGCCTCCATGAGAGGG + Intergenic
1202975699 15_KI270727v1_random:290855-290877 TGGCCCATTTGTCTAACAGATGG + Intergenic
1133087584 16:3376974-3376996 TGTCCTCTCTCTCTAAGAAAGGG + Intronic
1136384927 16:29918308-29918330 TGGCCCCTGGATCTAGGGGATGG - Intronic
1138652167 16:58466823-58466845 TGGCCCCTGTCTCTAAGAGATGG + Intronic
1139431089 16:66911411-66911433 TGGCCCCTGAGTCACAGAGAGGG - Intronic
1140349052 16:74244097-74244119 GGGCCACTCTCTCTAAGAAAGGG + Intergenic
1140480215 16:75258271-75258293 TTGCCCCAGTCTCTCAGACAAGG - Intronic
1141558620 16:84852564-84852586 TGGCCTCTGTCTTAGAGAGAGGG + Intronic
1143273963 17:5696213-5696235 AGGCCCCTGTCACTCAGGGAAGG + Intergenic
1144658458 17:17052946-17052968 TGGCCCCTTTATCTATGGGAAGG - Intronic
1145975937 17:28984420-28984442 TGGCCCTTGGCTCTCAGAGTAGG + Intronic
1149988289 17:61365268-61365290 TGGGCCCAGTCCATAAGAGATGG - Intronic
1150383931 17:64742675-64742697 TTGCCACTGTCCCTAAAAGATGG - Intergenic
1151884760 17:76916923-76916945 TGGCCCCAGTTTCTAAGAGGCGG - Intronic
1152550668 17:81028390-81028412 AGGCCACTGTCTCTAAGGCAGGG - Intergenic
1152716683 17:81903650-81903672 TGGCCCCTGGCTCGGAGAGCAGG + Intronic
1152727104 17:81952852-81952874 GGGGCCCTGTCCCGAAGAGACGG + Exonic
1156047045 18:32888676-32888698 TGGCCCCTGCCTTTCAAAGAGGG + Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1157328352 18:46685462-46685484 CAGCCCCTGTCTCTAGAAGAAGG - Intronic
1162087579 19:8257819-8257841 GGGCCCTGGTCTCAAAGAGAAGG - Intronic
1162311898 19:9913061-9913083 AGGACCCTGTCTCTGAAAGAGGG - Intronic
1162326818 19:10004322-10004344 TACCCCCTGTAACTAAGAGAAGG + Intronic
1162446311 19:10725001-10725023 TGGCTCCTGTCCCTGACAGATGG + Intronic
1162767609 19:12929502-12929524 TGGCCCCTTTTTCTTTGAGATGG + Intronic
1168108763 19:54180515-54180537 TGCCCCCTGTCGCTAGGAAAAGG - Intronic
1168558531 19:57363790-57363812 GGCCCCTTGTCTCGAAGAGAGGG + Exonic
926004963 2:9366370-9366392 TGGCCCCTGGCTCATAGAGGGGG + Intronic
927805540 2:26143478-26143500 TGGCCTCTGACTCTAAGATGGGG + Intergenic
928088858 2:28361931-28361953 AAGACCATGTCTCTAAGAGAGGG + Intergenic
930031566 2:47061157-47061179 TGGCCTGTGTCTACAAGAGAAGG - Intronic
932919675 2:75896874-75896896 TGCCTCCAGTCTCAAAGAGAAGG - Intergenic
933913735 2:86967427-86967449 TATCCCCTGTCTTTAAAAGAAGG + Intronic
935544986 2:104391417-104391439 GAGACCCTGTCTCTAAAAGAAGG + Intergenic
935772842 2:106443181-106443203 TATCCCCTGTCTTTAAAAGAAGG - Intronic
935907227 2:107852748-107852770 TATCCCCTGTCTTTAAAAGAAGG + Intronic
936129018 2:109817889-109817911 TATCCCCTGTCTTTAAAAGAAGG + Intronic
936215679 2:110553596-110553618 TATCCCCTGTCTTTAAAAGAAGG - Intronic
936424816 2:112408169-112408191 TATCCCCTGTCTTTAAAAGAAGG - Intronic
938244681 2:129767393-129767415 TGGCCCATCTCTCTGGGAGATGG - Intergenic
945967414 2:216203428-216203450 TGGCAGCTGCCTCTAAGAGCTGG - Intronic
948693913 2:239723156-239723178 TGGCCCATGTCTCTAATACATGG + Intergenic
948694968 2:239728631-239728653 CGGCCACTGTCTCCATGAGACGG - Intergenic
948853251 2:240718507-240718529 CGGCCCCAGTGTCTACGAGATGG - Intronic
1170279084 20:14625692-14625714 TGGCTCCTCTCACAAAGAGATGG - Intronic
1171161233 20:22925563-22925585 TGAGCCCTGTCTCTGCGAGAAGG - Intergenic
1171186807 20:23128793-23128815 TGGTCCCTGTCCCTTAGAGAGGG + Intergenic
1173175419 20:40761480-40761502 TGTCACCTGTCTCAAAGACATGG + Intergenic
1179089431 21:38250939-38250961 TGGACCCTATCTCTACCAGATGG - Intronic
1179338065 21:40476140-40476162 TAGCCCCTTTCTCTATGAGGTGG - Intronic
1180556067 22:16576142-16576164 TGGGGCATGTCTTTAAGAGAAGG + Intergenic
1180624577 22:17185750-17185772 AGGTCCCTTTCTCTGAGAGAAGG + Intronic
1182552222 22:31106601-31106623 GAGACCCTGTCTCTAAGAAAAGG - Intronic
1184178108 22:42801298-42801320 TGTCCCCTCTGTCTCAGAGAGGG - Intronic
1184921081 22:47606289-47606311 TGGCCCCTGGTTCTCACAGATGG + Intergenic
1185040500 22:48501496-48501518 TGGCCCATCTCTCCAAGGGAAGG + Intronic
950656535 3:14440425-14440447 TGGCCCGTGTCCCAAGGAGAAGG + Intronic
950657216 3:14444018-14444040 TATCCCCTGTCTCTAAGGGTGGG - Intronic
951066875 3:18277016-18277038 TGGCCCCTTTCTCTCTCAGATGG - Intronic
951072833 3:18352190-18352212 ATGCCCTTGTCTCTAAGGGATGG - Exonic
951641639 3:24843260-24843282 TGGTTCCTGTCTGGAAGAGATGG - Intergenic
955898638 3:63727519-63727541 TGGCCCCTGTTTCTAATGTAGGG - Intergenic
956133393 3:66075353-66075375 TTGCCCCTGTCTTTTAGAAATGG + Intergenic
957560507 3:81814962-81814984 TGTCCCCTGCCTCTAAAGGAAGG + Intergenic
959017050 3:101146652-101146674 TGTCCCCTGTCTAAATGAGAAGG - Intergenic
960093674 3:113667265-113667287 TGGCCCCTGTCTGCAGTAGAGGG - Intronic
961030374 3:123598000-123598022 AAGACCCTGTCTCTAAGAAATGG - Intergenic
963055205 3:141180924-141180946 GGGCACCTGTCTCTAATTGAAGG - Intergenic
964856652 3:161153013-161153035 AAGCCCCTGTCTCTAAAAAAGGG - Intronic
966369814 3:179238130-179238152 TGGGGCATGTCTTTAAGAGAAGG + Exonic
966659431 3:182398015-182398037 TGGCTCCCTTCTTTAAGAGATGG - Intergenic
967506733 3:190261021-190261043 TGTCCCCTCTCTCTAAGCTAAGG + Intergenic
969339443 4:6531015-6531037 TGGTCCCTGTCACTCAGAGCGGG - Intronic
971187704 4:24396373-24396395 TTCCCCCAGTCTCTAAGAGAAGG + Intergenic
974552429 4:63395907-63395929 TGGGCCCTGTCTCAAACAGAGGG + Intergenic
977246329 4:94636133-94636155 TGGCCCATGCCTCAAGGAGAAGG - Intronic
982089818 4:151870833-151870855 AGGCCCCTTTCTCCAAGACACGG + Intergenic
986203436 5:5600223-5600245 TAGCCCCTGTCTCTACAACATGG + Intergenic
987257814 5:16174829-16174851 TGGCCACTCTCTTTAAAAGAAGG + Intronic
989195395 5:38711695-38711717 GAGACCCTGTCTCTAAGAGGTGG - Intergenic
991619987 5:68534905-68534927 TTCTCCCTGTCTCTAAGAAAAGG - Intergenic
995608958 5:113889161-113889183 TGGCTCCTGTCTCTGTGGGAAGG + Intergenic
996282414 5:121746617-121746639 TGGCTCCTGTCTCTAAAAACGGG + Intergenic
997716109 5:136044260-136044282 TGGCCCCAGGCTCTATGCGAGGG + Intronic
997878854 5:137572225-137572247 TGGGCTCTGTCCCTAGGAGAGGG - Intronic
1004349799 6:14881022-14881044 TTGCCCTTGTCTCTAAAGGATGG - Intergenic
1005499197 6:26415011-26415033 TGGACTCTGTCTCCAGGAGAGGG + Exonic
1005982091 6:30844349-30844371 TTGCCCCTCTCTTTCAGAGATGG - Intergenic
1006693710 6:35912791-35912813 AGACCCCTGTCTCCAAAAGAAGG - Intronic
1006827503 6:36946811-36946833 GTGCCCCTGTCCCTCAGAGAGGG + Intergenic
1011474504 6:87737645-87737667 TGGTAGCTCTCTCTAAGAGAGGG + Intergenic
1012032139 6:94084901-94084923 GGGCAGCTGTCTCTAAGAGGGGG - Intergenic
1018867074 6:167754552-167754574 TGTCCCCTGTCTCTCAAAAAAGG + Intergenic
1023806369 7:43875725-43875747 TGGCTCCTGCCTTAAAGAGAGGG + Intronic
1023938335 7:44755264-44755286 TGGCCAGTGTTTCTAAGAAAGGG - Intronic
1026187806 7:68096146-68096168 AGGGCCCTATCTCTATGAGAAGG + Intergenic
1029680136 7:102102780-102102802 TGGCCCCAGCCCCCAAGAGAGGG - Intronic
1032210388 7:129909137-129909159 GAGCCCCTCTCTCTCAGAGAAGG + Intronic
1040988079 8:53318285-53318307 TGCCGCCTGGCTCTAAGAGCTGG - Intergenic
1042498620 8:69484877-69484899 TGACTCCTGTCTCGAAGAGGAGG - Intronic
1042573356 8:70191588-70191610 TGGCCTTTGTCTCTAAGAAAAGG + Intronic
1043364892 8:79521324-79521346 TGGCCCTTGTGTCTAAGACTGGG + Intergenic
1045049308 8:98308390-98308412 AAGCCCCTGTCTCAAAGAAAAGG - Intergenic
1046814150 8:118565486-118565508 TGGTCCTTGTCTCTAGGAGGTGG - Intronic
1046829418 8:118727974-118727996 TGGTTCCTGCCTCTCAGAGATGG + Intergenic
1048281442 8:133108372-133108394 AGGCCTCTCTCTCTAAGACATGG + Intronic
1049442973 8:142617571-142617593 TGGCCCCTGCCTTTCAGAGCAGG - Intergenic
1053302119 9:36959747-36959769 TGCCCACTGACTCTTAGAGATGG - Intronic
1059524472 9:114977670-114977692 AAGACCCTGTCTCTAAAAGAGGG - Intergenic
1060855880 9:126914885-126914907 TGGCCCCGGCCTCCAAGCGAAGG + Exonic
1061024481 9:128039207-128039229 TGGCTCCTGTCTGTAATTGAAGG + Intergenic
1185948157 X:4401235-4401257 TGGCTCCTGTCTCTATCAGTAGG - Intergenic
1185955286 X:4482523-4482545 AGGACCCTGTCTCTAAGAAAGGG - Intergenic
1189435340 X:40987840-40987862 TGCCTCCTGTCTCTAAGACCTGG + Intergenic
1189895068 X:45646885-45646907 CTGCCCCTCTCTGTAAGAGAGGG + Intergenic
1198952594 X:142088887-142088909 TTGCCCCTTTCTGTAAGAAAGGG + Intergenic
1200912881 Y:8546593-8546615 TGTCCCATGACCCTAAGAGAGGG + Intergenic
1200927662 Y:8669066-8669088 AGGCACCTGTCTCTCAGAGCTGG - Intergenic