ID: 1138654412

View in Genome Browser
Species Human (GRCh38)
Location 16:58482490-58482512
Sequence GGGGACAGTGCTACACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138654412_1138654416 4 Left 1138654412 16:58482490-58482512 CCTTCATGTGTAGCACTGTCCCC 0: 1
1: 0
2: 0
3: 16
4: 110
Right 1138654416 16:58482517-58482539 CGCATGACCCTTCTCACCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 39
1138654412_1138654423 25 Left 1138654412 16:58482490-58482512 CCTTCATGTGTAGCACTGTCCCC 0: 1
1: 0
2: 0
3: 16
4: 110
Right 1138654423 16:58482538-58482560 GGTCCCTGGGCACTGAATGTAGG 0: 1
1: 0
2: 0
3: 10
4: 186
1138654412_1138654418 11 Left 1138654412 16:58482490-58482512 CCTTCATGTGTAGCACTGTCCCC 0: 1
1: 0
2: 0
3: 16
4: 110
Right 1138654418 16:58482524-58482546 CCCTTCTCACCCGTGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 170
1138654412_1138654420 12 Left 1138654412 16:58482490-58482512 CCTTCATGTGTAGCACTGTCCCC 0: 1
1: 0
2: 0
3: 16
4: 110
Right 1138654420 16:58482525-58482547 CCTTCTCACCCGTGGTCCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138654412 Original CRISPR GGGGACAGTGCTACACATGA AGG (reversed) Intronic