ID: 1138657726

View in Genome Browser
Species Human (GRCh38)
Location 16:58500629-58500651
Sequence CCATCCAAGCGCACACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138657726_1138657731 0 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657731 16:58500652-58500674 TGTCTGCCTTGGTGATGCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 195
1138657726_1138657742 22 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657742 16:58500674-58500696 GGCCATCAGGCCAGGGGGCGGGG 0: 1
1: 0
2: 1
3: 21
4: 294
1138657726_1138657732 1 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657732 16:58500653-58500675 GTCTGCCTTGGTGATGCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 179
1138657726_1138657734 9 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657734 16:58500661-58500683 TGGTGATGCCTGGGGCCATCAGG 0: 1
1: 0
2: 1
3: 13
4: 247
1138657726_1138657735 14 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657735 16:58500666-58500688 ATGCCTGGGGCCATCAGGCCAGG 0: 1
1: 0
2: 5
3: 73
4: 519
1138657726_1138657736 15 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657736 16:58500667-58500689 TGCCTGGGGCCATCAGGCCAGGG 0: 1
1: 0
2: 2
3: 31
4: 324
1138657726_1138657739 17 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657739 16:58500669-58500691 CCTGGGGCCATCAGGCCAGGGGG 0: 1
1: 0
2: 3
3: 46
4: 382
1138657726_1138657730 -1 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657730 16:58500651-58500673 GTGTCTGCCTTGGTGATGCCTGG 0: 1
1: 0
2: 0
3: 19
4: 188
1138657726_1138657743 23 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657743 16:58500675-58500697 GCCATCAGGCCAGGGGGCGGGGG 0: 1
1: 0
2: 1
3: 26
4: 366
1138657726_1138657741 21 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657741 16:58500673-58500695 GGGCCATCAGGCCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 41
4: 439
1138657726_1138657737 16 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657737 16:58500668-58500690 GCCTGGGGCCATCAGGCCAGGGG 0: 1
1: 0
2: 2
3: 24
4: 336
1138657726_1138657740 20 Left 1138657726 16:58500629-58500651 CCCTCTGGTGTGCGCTTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1138657740 16:58500672-58500694 GGGGCCATCAGGCCAGGGGGCGG 0: 1
1: 0
2: 4
3: 50
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138657726 Original CRISPR CCATCCAAGCGCACACCAGA GGG (reversed) Intronic
903919354 1:26788260-26788282 TCATCCACGCTCACCCCAGAGGG - Exonic
905939802 1:41854071-41854093 CCATCCAAGAGGACAACAGGTGG - Intronic
913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG + Exonic
920564538 1:206962860-206962882 CCATCTAAGCACACATGAGAGGG + Intronic
920826465 1:209427971-209427993 CCTTCCAAGTGCACACCTGGAGG - Intergenic
921549668 1:216519365-216519387 CCATCCAAGCACTCTGCAGAAGG + Exonic
922889532 1:229049869-229049891 CAATCTAAGCTCACACCTGAAGG + Intergenic
924784619 1:247183775-247183797 CCATCTAGGCGGACACCACAGGG + Intergenic
1066436138 10:35398040-35398062 CCATCCATGCCCACTCCACATGG - Intronic
1069817438 10:71207333-71207355 CCCTCAAACAGCACACCAGAAGG - Intergenic
1071614932 10:87066606-87066628 CCGTCTAAGTGCAGACCAGAAGG + Intronic
1076506895 10:130984326-130984348 CCATCCTAACCCACACCAAAGGG - Intergenic
1076625316 10:131818216-131818238 CCAACCCACCACACACCAGAGGG - Intergenic
1076634570 10:131873960-131873982 CCAACCACGCCCACCCCAGAAGG + Intergenic
1078185690 11:9050483-9050505 CGATCCAAGCACACTGCAGATGG - Intronic
1079344861 11:19643046-19643068 ACACCCAACCCCACACCAGATGG - Intronic
1080302552 11:30800461-30800483 CCATCCAGGTGCCAACCAGAAGG - Intergenic
1084936130 11:72587637-72587659 CCATCCCAGTGCTGACCAGATGG - Intronic
1088016587 11:105068264-105068286 ACATCAAAGAGCACACTAGATGG + Intronic
1089607759 11:119651536-119651558 CAATCCAAGCCCCCACGAGAGGG - Intronic
1095121085 12:38420193-38420215 CAATCTAAGCTCACACCACATGG + Intergenic
1097244858 12:57602082-57602104 CCATCCTAGGGCCCACCAGGAGG - Exonic
1104702952 12:130921115-130921137 CCAACCAAGGGCACTTCAGAAGG + Intergenic
1115652880 14:35415696-35415718 CCATTAAAGAGCACCCCAGAAGG - Intergenic
1115880549 14:37912473-37912495 ACACCCAAGCGCACTCAAGAGGG + Intronic
1116803590 14:49468676-49468698 CCAGCCAAGCACACACCTCATGG + Intergenic
1118201503 14:63678355-63678377 CCTTCCAAGCCCTCACAAGAAGG - Intergenic
1119668189 14:76499379-76499401 CCATCCAAGAGCACCCCGGGGGG + Intronic
1122040605 14:98985128-98985150 ACAGCCAAGAGCTCACCAGATGG - Intergenic
1125977210 15:43965291-43965313 TCATCCTAGTGCACATCAGATGG - Intronic
1132721895 16:1320689-1320711 CCATCCATGCCCACCGCAGACGG - Intronic
1137571729 16:49570830-49570852 CCATCCCATCACTCACCAGAAGG + Intronic
1138657726 16:58500629-58500651 CCATCCAAGCGCACACCAGAGGG - Intronic
1144890463 17:18491204-18491226 CCACCCCAGCTCCCACCAGAGGG - Intronic
1145141754 17:20453114-20453136 CCACCCCAGCTCCCACCAGAGGG + Intronic
1146017611 17:29246669-29246691 CCAGCCATGCCCACAACAGAGGG + Intergenic
1159587046 18:70290879-70290901 CCACCCAAGCGCACACCCTCGGG + Intronic
1160553062 18:79707421-79707443 GCAGCCAAGCGCCCACCAGCAGG - Intronic
1161065819 19:2236777-2236799 CCAGGCATGCGCACACCAGAGGG + Exonic
1161368321 19:3893994-3894016 CCAGGCAAGAGCACTCCAGATGG - Intronic
1162779738 19:13000803-13000825 CCAGCCAAGTGCCCACCATAGGG - Intronic
1165899639 19:39163098-39163120 CCATCAAAGCACATGCCAGAAGG + Intronic
1167100453 19:47401550-47401572 CCATCCAGGCCCACCCCAAAGGG + Intergenic
927508623 2:23630400-23630422 CCATCCCAGAGCACATCTGAAGG + Intronic
934847672 2:97672647-97672669 CCAGCCCAGCTCACACCAGGTGG + Intergenic
934849436 2:97688063-97688085 CCAGCCCAGCTCACACCAGGTGG + Intergenic
939169984 2:138684680-138684702 CCATCCAAGTCCAGACCAGAAGG + Intronic
939853895 2:147333847-147333869 CTTTCAAAGTGCACACCAGAGGG + Intergenic
941469681 2:165869085-165869107 CCAGCCAAGGGCACAGGAGATGG - Intronic
946734524 2:222741038-222741060 CCATCCAAGCCCAGACCAGGTGG - Intergenic
1170963802 20:21048982-21049004 CCATCAGAGCGCCCACTAGAGGG + Intergenic
1172683707 20:36737328-36737350 CCATCTAAGAGCACACCCCAGGG - Intronic
1173475773 20:43358336-43358358 CCATCCATACCCACACCATAGGG + Intergenic
1174193763 20:48758392-48758414 CCACTCCAGGGCACACCAGAGGG - Intronic
1175022783 20:55868844-55868866 CCATAAAAGCCCAGACCAGATGG + Intergenic
1175181043 20:57147910-57147932 CCATCAAGGCACACACCAGATGG + Intergenic
1175186660 20:57183614-57183636 CCATTCAGGTGCTCACCAGATGG - Intronic
1176149961 20:63585737-63585759 CCAGCCCAGGGCACTCCAGAAGG - Intergenic
1184252357 22:43268019-43268041 CCTTCCAAGCTCACAGCAGAGGG - Intronic
950103095 3:10370253-10370275 CAATCCAAGCCCACCCCACAGGG + Intronic
952953543 3:38542868-38542890 CCATCCGAGGGCATCCCAGAGGG - Intergenic
960185470 3:114632607-114632629 CCTTTCAAGCGAACACCACAGGG - Intronic
980971774 4:139573814-139573836 CCTTCCAAGGGCACAACAGTGGG + Intronic
984977452 4:185242262-185242284 CCAAGCAAGCGGACACCAGCTGG + Intronic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
992490125 5:77234575-77234597 GCACCCAAGGGCAAACCAGAGGG - Intronic
994944239 5:106364667-106364689 CCATACAAGCACACACGAAAAGG - Intergenic
995000601 5:107123016-107123038 CCAACCAAGCCCAAATCAGAAGG + Intergenic
996477330 5:123936689-123936711 CCATCCCAGGTCACACCAAAAGG - Intergenic
998423958 5:142011896-142011918 CCATCCAAGAACGCACCAGTGGG + Exonic
1000104040 5:158041801-158041823 CCACCCAAGTGCACTCCATATGG - Intergenic
1000122664 5:158212151-158212173 CCCTCCAATTGCACATCAGATGG + Intergenic
1014310043 6:119788237-119788259 CAGACCAAGCGCCCACCAGAAGG + Intergenic
1019513940 7:1431582-1431604 CCACCCCAGAGCTCACCAGAAGG + Intronic
1020123740 7:5520727-5520749 CTATCCACACGCCCACCAGAGGG - Intergenic
1030186644 7:106768963-106768985 TCAACCCAGCGCACAGCAGACGG + Intergenic
1032620445 7:133525134-133525156 CCATCCTAACGTACCCCAGAAGG - Intronic
1034749730 7:153557644-153557666 ACATCCGAGCTCACAACAGAGGG - Intergenic
1041931787 8:63295174-63295196 CCATCCCAGCCTACAGCAGATGG - Intergenic
1044942052 8:97353565-97353587 ACGCCCAAGCTCACACCAGATGG + Intergenic
1049183790 8:141238076-141238098 CCAGCTAACCGCACACTAGAGGG - Intronic
1051915907 9:22207453-22207475 CCATCCCTGCCCACACCAAAGGG - Intergenic
1053481363 9:38418788-38418810 CCATCCAAGGGCTAACCAGCAGG + Intronic
1060059254 9:120444400-120444422 CTCCCCAAGCCCACACCAGATGG + Intronic
1062015834 9:134290884-134290906 ACACCCAAGCCCACACCAGCAGG - Intergenic
1185939681 X:4302187-4302209 CCATCCAAGGGAATAGCAGAGGG - Intergenic
1193415472 X:81217337-81217359 CCATCTAAGCTCACACCTAATGG - Intronic
1199969229 X:152846656-152846678 CCATCCAAGAACACCCCAGCTGG - Intronic
1201723007 Y:17122770-17122792 CCATCCAAGGGAATAGCAGAGGG - Intergenic