ID: 1138657834

View in Genome Browser
Species Human (GRCh38)
Location 16:58501037-58501059
Sequence GAGGTGCCCTGGGCTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 346}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138657834_1138657854 30 Left 1138657834 16:58501037-58501059 CCAGGTGGAGCCCAGGGCACCTC 0: 1
1: 0
2: 5
3: 44
4: 346
Right 1138657854 16:58501090-58501112 CATTCTTCCTCAGGAGGGAGAGG 0: 1
1: 0
2: 2
3: 25
4: 257
1138657834_1138657843 4 Left 1138657834 16:58501037-58501059 CCAGGTGGAGCCCAGGGCACCTC 0: 1
1: 0
2: 5
3: 44
4: 346
Right 1138657843 16:58501064-58501086 CGCCGGGGCATCAGGTACCCCGG 0: 1
1: 0
2: 0
3: 5
4: 81
1138657834_1138657850 25 Left 1138657834 16:58501037-58501059 CCAGGTGGAGCCCAGGGCACCTC 0: 1
1: 0
2: 5
3: 44
4: 346
Right 1138657850 16:58501085-58501107 GGCCCCATTCTTCCTCAGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 161
1138657834_1138657849 24 Left 1138657834 16:58501037-58501059 CCAGGTGGAGCCCAGGGCACCTC 0: 1
1: 0
2: 5
3: 44
4: 346
Right 1138657849 16:58501084-58501106 CGGCCCCATTCTTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 25
4: 162
1138657834_1138657841 -4 Left 1138657834 16:58501037-58501059 CCAGGTGGAGCCCAGGGCACCTC 0: 1
1: 0
2: 5
3: 44
4: 346
Right 1138657841 16:58501056-58501078 CCTCCTCTCGCCGGGGCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 104
1138657834_1138657846 21 Left 1138657834 16:58501037-58501059 CCAGGTGGAGCCCAGGGCACCTC 0: 1
1: 0
2: 5
3: 44
4: 346
Right 1138657846 16:58501081-58501103 CCCCGGCCCCATTCTTCCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138657834 Original CRISPR GAGGTGCCCTGGGCTCCACC TGG (reversed) Intronic
900012834 1:131463-131485 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
900042899 1:487450-487472 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
900064336 1:722447-722469 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
900156806 1:1206455-1206477 GAGGCGCCCAGGGCCGCACCCGG + Exonic
900250967 1:1669506-1669528 GAGTTGCCCTGGGAGCCACTCGG - Intronic
900423180 1:2564501-2564523 TAGGGGCCCAGGGCTCCACCTGG - Intronic
900589258 1:3452494-3452516 GAGGTGGCCTGAGCTCCTGCGGG - Intergenic
900595009 1:3476654-3476676 GAGGGGCCCTGGGCTGTCCCAGG - Intronic
900598861 1:3494549-3494571 GAGGTGCCCTGGGCTGCCATAGG - Intronic
903366776 1:22810279-22810301 CAGGGGCCCTGGGCTCGGCCAGG + Intronic
904205994 1:28855576-28855598 GAGGAGCCCGGGGCCCTACCTGG + Intronic
905876215 1:41433449-41433471 GAGGGGCCCTGGGCTGCAGGGGG - Intergenic
913088205 1:115458313-115458335 GACGTGCCCTGGGCTTCAGGGGG - Intergenic
913606931 1:120475533-120475555 TGGGTGCCCTGGCCTCCTCCAGG + Intergenic
913988412 1:143586073-143586095 TGGGTGCCCTGGCCTCCTCCAGG - Intergenic
914209501 1:145564611-145564633 TGGGTGCCCTGGCCTCCTCCAGG - Intergenic
914584261 1:149046305-149046327 TGGGTGCCCTGGCCTCCTCCAGG - Intronic
914914662 1:151811812-151811834 AAGGTGCCCAGGCCTGCACCAGG + Intronic
915340189 1:155173110-155173132 GACGTGTCCTGGGTTCCACCGGG - Intronic
915587034 1:156849460-156849482 AAGGTCCCCTGGCCTCCCCCAGG - Exonic
916379685 1:164195829-164195851 GAGCTGCAGTGGGCTCCACCTGG - Intergenic
916822136 1:168410015-168410037 GAAGTGCCCTGGACAGCACCAGG - Intergenic
917202514 1:172532824-172532846 GAGGATCACTGGGCTCCTCCCGG + Intronic
920656502 1:207879490-207879512 GAGGTGCTCTGGGCTCCAACAGG - Intergenic
922099235 1:222468459-222468481 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
922261273 1:223947953-223947975 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
924744855 1:246822395-246822417 GAGGAGCCCTGAGCACCACCGGG - Intergenic
1063363833 10:5478065-5478087 GGGGTCCCCTGGGGACCACCAGG - Intergenic
1064028753 10:11869830-11869852 GGGGTGCCTTGGGCTGCGCCGGG - Exonic
1066734037 10:38455422-38455444 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1066746007 10:38604586-38604608 GAGGCACCCTGGAGTCCACCAGG - Intergenic
1066785134 10:38995240-38995262 GAGCTGCGGTGGGCTCCACCTGG + Intergenic
1067177445 10:43960050-43960072 ACGGTGCTCTGGGCTCCATCTGG + Intergenic
1067249712 10:44576169-44576191 GTGCTGCCCTGGGCGCCACGGGG - Intergenic
1067478430 10:46580759-46580781 ATGGTGCCCTGGCCTCCTCCTGG + Intronic
1067616307 10:47761042-47761064 ATGGTGCCCTGGCCTCCTCCTGG - Intergenic
1067793917 10:49307223-49307245 GAGGTGCCCTTGGCTTCTCCTGG - Intronic
1068214691 10:53968363-53968385 GAGCTGTGGTGGGCTCCACCCGG - Intronic
1068900909 10:62268571-62268593 GAGGGGTCCTGCGCTCCGCCTGG - Exonic
1069798854 10:71070097-71070119 GGGGTGCCCTGGCCTCTGCCTGG - Intergenic
1069833242 10:71293747-71293769 GACAGGCCCTGGGCTCCAGCTGG - Exonic
1069917814 10:71798119-71798141 GAAGGGCCGAGGGCTCCACCAGG + Intronic
1070775501 10:79107582-79107604 GAGGTGCACTGGGCACCACCGGG + Intronic
1072388767 10:94960255-94960277 GAGCTGCGGTGGGCTCCACCTGG + Intronic
1073186911 10:101620518-101620540 GGGTTGCCCTGGGCACCACTTGG - Intronic
1073300971 10:102470762-102470784 TGGGTGCCCTGGGCCCCAGCTGG + Exonic
1074027640 10:109652859-109652881 GAGCTGTGGTGGGCTCCACCCGG - Intergenic
1074360520 10:112821377-112821399 GAGAGGGCCTGGGCTCCCCCAGG - Intergenic
1075567386 10:123514575-123514597 GAGAGGCCCAGGGCTGCACCAGG + Intergenic
1075903875 10:126064292-126064314 GAGGGGCCCAGGGCTCCATGGGG - Intronic
1076368310 10:129936249-129936271 GAGGTCCCCTGGCTTCTACCAGG + Intronic
1076692543 10:132231075-132231097 CATGTGGCCTGGGCTCCATCTGG + Intronic
1076969172 11:123667-123689 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1077374576 11:2199529-2199551 CAGGTGACCTGGCATCCACCAGG + Intergenic
1077409202 11:2395623-2395645 GAGGTGCCCTTGGGACCTCCAGG + Intronic
1077429297 11:2508087-2508109 GAGCTGGCCTGGGCCCCAGCAGG + Intronic
1077467942 11:2742514-2742536 TGGGGGCCCTGGGCTCCCCCCGG + Intronic
1077501487 11:2911525-2911547 GAGGAGCACTGGGCCCCAGCAGG + Intronic
1077546062 11:3170560-3170582 GCGCTGCCTTGGGCTCCAGCTGG + Intergenic
1079081260 11:17415155-17415177 GAGGGCCCCTGTGCTCCACCAGG - Intronic
1079226204 11:18607230-18607252 GTGGTACCCTGGCCTCCAACTGG + Exonic
1079290722 11:19185547-19185569 GAGAAGCCCTGGGCTGTACCTGG - Intronic
1081872478 11:46389737-46389759 GAGCTGCCCTCGGCTCCGCGCGG + Intergenic
1083301083 11:61739908-61739930 GAGCTGCCCTGGGGCACACCAGG - Intronic
1083880150 11:65544364-65544386 GATAAGCCCTGGGCTCCAGCTGG - Intronic
1083941979 11:65900667-65900689 GGGGAACCCGGGGCTCCACCTGG - Intergenic
1084172996 11:67409607-67409629 GCGGTGGTCTGGGCTCCTCCGGG - Exonic
1084694524 11:70745676-70745698 GAGCTGGCCTGGCCCCCACCTGG + Intronic
1084786415 11:71444251-71444273 CATCTGCCCTGGGCCCCACCAGG + Intronic
1085297982 11:75441617-75441639 GCCCTGCCCTGGGCTCCTCCAGG - Intronic
1085463099 11:76706970-76706992 GAGGGGCCCTGGGGCCCCCCAGG - Intergenic
1085523501 11:77151539-77151561 GAGGCCCCCTGAGCTCCGCCTGG + Intronic
1085533572 11:77205433-77205455 GAGGAGGCGTGGGCTCCAGCAGG - Intronic
1085827673 11:79865109-79865131 GAGCTGCAGTGGGCTCCGCCCGG - Intergenic
1088895785 11:114077358-114077380 GAGGTGGCCTGGGGTCCAGGTGG - Intronic
1088911898 11:114198512-114198534 GAGGGGCCCTGGGAGCCACTAGG - Intronic
1089140356 11:116279323-116279345 GCGGTTCCCTGAGCTCCCCCAGG + Intergenic
1089384618 11:118059640-118059662 GGGGTGCCCTGGGGTCCGTCAGG + Intergenic
1091302707 11:134517651-134517673 GAGGTGTCCAGGATTCCACCAGG - Intergenic
1091330437 11:134727705-134727727 GGGTTGCCTTGGGCTCCAGCAGG - Intergenic
1092417957 12:8306663-8306685 GAGCTGTGGTGGGCTCCACCCGG + Intergenic
1093465054 12:19440170-19440192 GCGGTCCCTTGGGCTCCTCCAGG - Exonic
1095049411 12:37543257-37543279 GTGGTTGCCTTGGCTCCACCTGG + Intergenic
1096257917 12:50074092-50074114 GGGGTGCCCCTCGCTCCACCGGG + Intronic
1096396584 12:51270481-51270503 CAGGTCCCCTTGGCTCCCCCGGG + Exonic
1098549491 12:71747456-71747478 GTGGGGACCTGGGCTACACCGGG + Intergenic
1101966617 12:109286596-109286618 GAGCTGCCCTGGTCTCTTCCTGG - Intronic
1102045528 12:109827995-109828017 GGAGTGGCCTGGGTTCCACCCGG - Intronic
1102679732 12:114683210-114683232 GCGGGGCGCTGGGCTCCAGCCGG + Exonic
1103726362 12:122999241-122999263 GAGAAGCCCTTGGCTCCTCCTGG - Intronic
1104688340 12:130805403-130805425 GACTTCCCCTGGGCTCCACCTGG - Intronic
1104925625 12:132312721-132312743 CAGGTCCCCTGGACTCCACTGGG - Intronic
1104951815 12:132444499-132444521 GGGGTCTGCTGGGCTCCACCGGG + Intergenic
1106230940 13:27820688-27820710 GGGGCACCCTGGTCTCCACCTGG + Intergenic
1106313653 13:28575485-28575507 GAGGGCCCCTGGGCTCCTGCAGG - Intergenic
1112388049 13:98958299-98958321 GAGGTGCCGTGGGCTGGAGCTGG - Intronic
1113344000 13:109455866-109455888 GTGGTGACCTTGGTTCCACCTGG + Intergenic
1113638375 13:111938047-111938069 GGGGAGCCCTGGGCACCAGCTGG - Intergenic
1113825230 13:113247401-113247423 GAGGTGTCCTGCCCTACACCTGG - Intronic
1113917882 13:113884964-113884986 CAGGTTACCTGGGCCCCACCAGG + Intergenic
1114581267 14:23762338-23762360 GAGCTGCAGTGGGCTCCACTTGG + Intergenic
1118038868 14:61896277-61896299 CAGGTCCCCTGGGCTATACCTGG + Intergenic
1120869464 14:89323988-89324010 GAGTTGCCCAGGGCACCACAAGG - Intronic
1121525159 14:94614378-94614400 GAGGTGGTCGGGGCTCCATCTGG + Exonic
1122402332 14:101474870-101474892 GCGGTGCCTCGTGCTCCACCTGG - Intergenic
1122413395 14:101537360-101537382 AAGGTGCCCTCTGCTCCCCCAGG + Intergenic
1122817536 14:104320969-104320991 GAACTGGCCTGGGCTCCGCCAGG + Intergenic
1123582782 15:21731240-21731262 CTGGTGTCCTGGGCTCCCCCTGG + Intergenic
1123619432 15:22173836-22173858 CTGGTGTCCTGGGCTCCCCCTGG + Intergenic
1123716708 15:23039198-23039220 GCGGTGCCCTGCGCACCACAGGG - Intronic
1124058043 15:26260703-26260725 GAAGAGCCTTGGGCTCCCCCTGG + Intergenic
1124373956 15:29118883-29118905 GCGGTGGCCTGGGGTCCAGCTGG + Intergenic
1124500058 15:30220518-30220540 GTGGTGCTCTGGGCTGCATCAGG + Intergenic
1124652394 15:31483568-31483590 GCGGTGCCCGGGGCCCTACCGGG - Exonic
1124743517 15:32318148-32318170 GTGGTGCTCTGGGCTGCATCAGG - Intergenic
1125607964 15:40952999-40953021 GACGTGCCCTGGACTCGACTTGG + Intronic
1125788443 15:42343684-42343706 TCAGTGCCCTGGGCTCCAGCAGG - Intronic
1126554103 15:49966512-49966534 GAGCTGCAGTGGGCTCCGCCTGG - Intronic
1128585821 15:68849349-68849371 GAGGTGGCTGGGGCTACACCTGG - Intronic
1129188910 15:73926560-73926582 GCGGTGCCCAGGGCTGCACGAGG - Exonic
1129334379 15:74843477-74843499 GAGGGGCCCTGGGAGCCTCCCGG - Intergenic
1129578517 15:76780384-76780406 GAGCTGCTGTGGTCTCCACCTGG - Intronic
1129891510 15:79074828-79074850 GATGGGCCCAGAGCTCCACCTGG + Intronic
1131157435 15:90083877-90083899 GAGGTGCTCTGGTCTGCCCCAGG + Exonic
1132246549 15:100300568-100300590 AAGGAGCCTTGGGCTCCACCAGG + Intronic
1132464178 16:70138-70160 CAGGTGCCCTGAGCTGCACTTGG - Intronic
1132558366 16:582558-582580 GGGCTGCCCTGGGCCCCACAGGG + Intronic
1132591007 16:726481-726503 GCGGTGCCCTGGGAGTCACCTGG - Intronic
1132600486 16:770641-770663 GAGGGGGGCTGGGCTCCACCAGG + Exonic
1132600529 16:770733-770755 GAGGGGGGCTGGGCTCCACCAGG + Intronic
1132695010 16:1198193-1198215 GAGGGCCACTGGGCTCCGCCTGG + Intronic
1134062936 16:11209938-11209960 GAGGGGCCCAGGGCTCCAGTGGG + Intergenic
1134510951 16:14846476-14846498 GAGGGTTCCTGGGCTCCACCTGG + Intronic
1134698594 16:16244967-16244989 GAGGGTTCCTGGGCTCCACCTGG + Intronic
1134973241 16:18549706-18549728 GAGGGTTCCTGGGCTCCACCTGG - Intronic
1137403891 16:48175364-48175386 GGCCTGCCATGGGCTCCACCAGG + Exonic
1138438653 16:57021065-57021087 GTGGGTCCCTGGGCTCCTCCCGG - Intronic
1138657834 16:58501037-58501059 GAGGTGCCCTGGGCTCCACCTGG - Intronic
1138720380 16:59072754-59072776 GAGTTGTGGTGGGCTCCACCGGG - Intergenic
1139311656 16:66032902-66032924 GAGGTTCCAGGGGCTCCCCCTGG - Intergenic
1139505642 16:67396824-67396846 GGGGGGCCCTGGGCTCCAGAGGG + Intronic
1141894103 16:86947467-86947489 GAGGAGCTCTGGGGTCCACCAGG + Intergenic
1142451503 16:90175455-90175477 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1142627337 17:1200701-1200723 GACGTGCCCGGGTTTCCACCTGG - Intronic
1143598950 17:7931695-7931717 GAGGTCGCCCGGGCTGCACCGGG + Intronic
1144166376 17:12615053-12615075 GAGGTGCCCTGTGCACCCTCAGG + Intergenic
1144766471 17:17735692-17735714 GAAGTGGCCTGGGCTGCTCCAGG + Intronic
1145057600 17:19713805-19713827 CAGGTGCGCTGGGCTCCGGCTGG - Exonic
1145261047 17:21355070-21355092 GAGGGGCCCTGGGCTCGGCTTGG - Intergenic
1145759035 17:27415492-27415514 GATGTGGCCAGGGCTCCACAAGG + Intergenic
1146629469 17:34459474-34459496 GAGGCTGCCTGGGCTCCATCTGG - Intergenic
1146928514 17:36761798-36761820 AAGGGGCCCTGGGCCGCACCCGG - Intergenic
1148158196 17:45435365-45435387 GGGGTCCCCTGGGCTTCTCCTGG + Intergenic
1148773367 17:50079486-50079508 GGGGGGCCCTGGCCTCCCCCTGG - Exonic
1149478341 17:56982217-56982239 GAGGGGCCCAGGGTTCCAGCTGG - Intronic
1149550152 17:57533830-57533852 GATGTGACCTGGGCTTCCCCTGG + Intronic
1149684416 17:58527204-58527226 GGGGTGCCCAGGGCTCTTCCTGG - Intronic
1150217429 17:63478184-63478206 GAGGAACCCTGGGATCCACATGG + Intergenic
1150692365 17:67377463-67377485 GAGGCGCCCGGGGCCCCAGCCGG + Intronic
1152595286 17:81234790-81234812 TGGGTGCCCTGGGCTCCTGCAGG - Intronic
1152702145 17:81824464-81824486 CAGGTGGGCTGGTCTCCACCGGG - Intronic
1153000692 18:452846-452868 TAGCTGCCCTGTGCTCCACTTGG - Intronic
1153256146 18:3173427-3173449 GAGGTGCCATGGCCTCACCCAGG + Intronic
1153675344 18:7451914-7451936 GACTTGCCGTAGGCTCCACCTGG - Intergenic
1154019515 18:10650494-10650516 GAGCTGCGGTGGGCTCCACCCGG - Intergenic
1160240497 18:77119216-77119238 GAGGTGTCCTGGAAGCCACCAGG + Intronic
1160296010 18:77637589-77637611 GAGCTGTGGTGGGCTCCACCTGG - Intergenic
1160571292 18:79819249-79819271 GTGGTGTCCTGGGCTGCACCCGG - Intergenic
1160645977 19:193593-193615 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1160750312 19:731033-731055 AAGGTGCCCAGAGCCCCACCGGG + Intronic
1161297176 19:3526025-3526047 GAGGGGCCCTGGGCTTCCCGGGG - Intronic
1161680694 19:5678358-5678380 TCGGTGCTCTGGGCACCACCAGG + Intronic
1162109262 19:8391269-8391291 CAGGTGGCCTGGGCTCAATCGGG - Intronic
1162555702 19:11384221-11384243 CAGGAGCCCTGGGCTCCCCGTGG - Exonic
1162830847 19:13283275-13283297 GAGGTGCGTTGGGCTGCACAGGG + Exonic
1163692503 19:18745291-18745313 GAGCAGCCCTGGGCTCCACAAGG + Intronic
1163775332 19:19213979-19214001 TAGGTCCCATGTGCTCCACCCGG + Intronic
1165108488 19:33487939-33487961 GTGGGGCCCTGGGCTTCCCCAGG - Intronic
1165134618 19:33660000-33660022 ACTGGGCCCTGGGCTCCACCAGG + Intronic
1166475445 19:43120613-43120635 GAGATCCCCTTGGCTCCACAAGG + Intronic
1166998858 19:46733102-46733124 GGGGCCCCCAGGGCTCCACCAGG - Exonic
1167264750 19:48478028-48478050 GAGGGGGCCTGGGCTCAACAGGG - Intronic
1167381936 19:49143185-49143207 GAGGTGGCCTGGGCCCCTCCTGG - Intronic
1167595802 19:50427557-50427579 CAGGTGCCCTGGCCTCTCCCGGG + Intronic
1168330422 19:55564548-55564570 GAGGGGCCCGAGGCTCCACGGGG - Intergenic
927034900 2:19164246-19164268 GAGCTGTGGTGGGCTCCACCCGG + Intergenic
927093138 2:19727770-19727792 CAGGAGCCCTGGGTTCTACCCGG - Intergenic
927487453 2:23498380-23498402 GAGGTGCCCTGACATCCAGCTGG + Intronic
929268006 2:39940413-39940435 GGGGTGGCCTGAGCTGCACCTGG + Intergenic
930223315 2:48767485-48767507 GAGCTGCAGTGGGCTCCGCCCGG + Intronic
934188196 2:89764176-89764198 GAGGTACCCTGGAGGCCACCAGG + Intergenic
934520517 2:95017405-95017427 GAGGCCCCCTGGGCTCCCCCAGG - Intergenic
934789137 2:97043505-97043527 GATGTTTCCTGGGCTCCACAAGG + Intergenic
934817341 2:97339036-97339058 GATGTTTCCTGGGCTCCACAAGG - Intergenic
934820355 2:97369448-97369470 GATGTTTCCTGGGCTCCACAAGG + Intergenic
934999674 2:99000980-99001002 GAGCTGTGGTGGGCTCCACCCGG - Intronic
936093191 2:109513945-109513967 GAGGCTGCCTGGGCTCCACCCGG - Intergenic
936096463 2:109533978-109534000 GCGCTGCCCTGGGCTCCTCCCGG - Intergenic
936247462 2:110840891-110840913 CAGGTGGCCTGGGCTCCACTTGG + Intronic
936522153 2:113218149-113218171 GAGGTGCCCTGTGCACCCCTTGG + Exonic
937239143 2:120449227-120449249 AAGGTGCCCTGAGCTCCCCTGGG - Intergenic
937403694 2:121608341-121608363 GAGGGGACTTGGACTCCACCTGG - Intronic
938265892 2:129927984-129928006 GAGGAGCCCTGGAATCCAGCTGG + Intergenic
940946518 2:159624089-159624111 GAGCTGTGGTGGGCTCCACCCGG - Intergenic
947542855 2:230990690-230990712 GAGGCGCCAGGGGCTCCTCCTGG + Intergenic
948301984 2:236914482-236914504 GAGGAGGCCTGGCCTCCTCCTGG - Intergenic
948423045 2:237872244-237872266 GAGGTGCCCCCGGCAGCACCAGG - Intronic
948427529 2:237897125-237897147 GCGGGGCTCTGGGGTCCACCTGG - Intronic
948469919 2:238170757-238170779 GAGCTGCTCTGGTCTCCATCAGG + Intronic
949036470 2:241817738-241817760 GAGGGGGCTTGGGCTCCACTGGG + Intergenic
1169159837 20:3368231-3368253 GGAGTGCGCTGGGCACCACCTGG + Intronic
1171543940 20:25986772-25986794 GTGGTCGCCTTGGCTCCACCTGG + Intergenic
1172600178 20:36177873-36177895 GAGATACCCTGGGCTCCACCAGG - Intronic
1172602750 20:36195195-36195217 CAGCTGCCCTGGCCTCCACTTGG + Intronic
1172656529 20:36541622-36541644 GAGGTGGCCCGGGCCCGACCCGG + Intronic
1172942510 20:38664127-38664149 AGGGTTCCCTGGGCTCCAGCAGG + Intergenic
1174055981 20:47798796-47798818 GCGGTGCCCTGGTCTGCACAGGG - Intergenic
1175419979 20:58825398-58825420 GAGGTGCTCAGGGCTGCACCTGG + Intergenic
1175891327 20:62317305-62317327 GAGGGGCCCTGGGCCCACCCTGG - Intronic
1175965429 20:62657941-62657963 GAGGGGCCCAGGGCTGCCCCAGG - Intronic
1176096281 20:63345916-63345938 CAGGTGGCCAGGGCTCCACGGGG - Exonic
1176100549 20:63362436-63362458 GAGGAGCCATGAGCTCAACCTGG - Intronic
1176279529 20:64292623-64292645 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1176389924 21:6158203-6158225 AGGGAGCCCTGGGCCCCACCCGG - Intergenic
1177344865 21:19855197-19855219 GAGGAGCCCTGGGACCCATCAGG + Intergenic
1179508661 21:41858247-41858269 GACGTGTCCTGGGCTCGTCCCGG - Intronic
1179628498 21:42662205-42662227 GTGGCGCCCGGGTCTCCACCAGG - Intronic
1179733542 21:43380037-43380059 AGGGAGCCCTGGGCCCCACCCGG + Intergenic
1179953319 21:44723908-44723930 GAGATGCCCTGGTCTGCCCCCGG + Intergenic
1180186384 21:46141902-46141924 TGGGTGCCCTGGGCCCCCCCGGG + Intronic
1180221806 21:46364015-46364037 GAGGCGCTGTGGGCTCCACTGGG + Intronic
1180782885 22:18530482-18530504 CAGGTGCCCTGGAGTCCACCTGG - Intronic
1180866838 22:19124545-19124567 GAGGGGCCCAGGGTTCCACTTGG + Intergenic
1181031508 22:20150552-20150574 GAGGGGCCCTGGCCTCGCCCAGG - Exonic
1181126448 22:20704513-20704535 CCGGTGCCCTGGAGTCCACCTGG - Intergenic
1181130587 22:20729294-20729316 GTGGTGCCCGGGGGCCCACCTGG + Exonic
1181239783 22:21469844-21469866 CAGGTGCCCTGGAGTCCACCTGG - Intergenic
1181673094 22:24435045-24435067 GAGCTGCACTGGGCTGCTCCAGG + Intronic
1182489656 22:30662940-30662962 GAGGTGGCCTGGGACCCCCCAGG + Exonic
1183082527 22:35465564-35465586 GAGGTGGCCAGGGCTCCTCTCGG + Intergenic
1183280578 22:36929877-36929899 CAGGGTTCCTGGGCTCCACCTGG + Intronic
1183308487 22:37096782-37096804 GAGGTGCCCTTTGCTCCTACTGG + Intronic
1183473861 22:38025003-38025025 GTGGAGGCCTTGGCTCCACCTGG - Intronic
1183678439 22:39312803-39312825 GAGGTGCCTTGTGCTCCCCAAGG - Intergenic
1184088993 22:42282736-42282758 GAGCTGCCCAGGCCTCCTCCGGG + Intronic
1184172095 22:42765773-42765795 AAGGATCCCTGAGCTCCACCTGG - Intergenic
1184333908 22:43842034-43842056 CAGTCGCCCTGGGCCCCACCTGG - Intronic
1184453797 22:44597930-44597952 GGGGTGCCCTGCGCTCAACCGGG - Intergenic
1184649355 22:45912589-45912611 CACTTGCCCTGGGCTCCCCCTGG - Intergenic
1184840398 22:47049091-47049113 GAGGAGGCCGGCGCTCCACCTGG + Intronic
1185008424 22:48299459-48299481 GAGGTATCCTGGGCTCCCACAGG + Intergenic
1185186957 22:49407024-49407046 GAGGTGCTGTGGGTTCCTCCTGG + Intergenic
950520139 3:13493239-13493261 GAGGAGCTCAGGGCACCACCAGG - Intronic
950724297 3:14906470-14906492 GAGGTCTCCTGGCCTCCTCCTGG + Intronic
952537566 3:34328099-34328121 TAGTTGCCCTGGGATCCATCAGG - Intergenic
954361978 3:50126871-50126893 TAGGTCTCCTGGGCTCTACCTGG + Intergenic
954392246 3:50273859-50273881 GCGGGCCGCTGGGCTCCACCCGG + Intronic
954424802 3:50437722-50437744 GAGTTGCCCTGGGCTCTCCTGGG - Intronic
956309309 3:67861339-67861361 GAGGTGGACTGGGCTCAACTTGG + Intergenic
958631130 3:96685391-96685413 GAGGTGCCCCAGGCTCCAGGTGG + Intergenic
959723047 3:109513861-109513883 GAGCTGTGGTGGGCTCCACCTGG + Intergenic
960832348 3:121863324-121863346 GAGCTGCGGTGGGCTCCACCTGG + Intronic
961448693 3:126992699-126992721 GGGGTGCCCTGGGGTCCTGCTGG + Intronic
961606373 3:128098548-128098570 GAGCTGCCCTGTGCTCTACTAGG + Intronic
964602437 3:158516605-158516627 GAGCTGTGGTGGGCTCCACCCGG + Intronic
964646087 3:158959802-158959824 GAGGTGCCCTGGTCACCAGGAGG + Intergenic
965271089 3:166617935-166617957 GAGCTGCAGTGGGCTTCACCCGG - Intergenic
965590766 3:170358111-170358133 GGGATGCCCTGGTCTCGACCCGG + Intronic
968371704 3:198225933-198225955 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
968454028 4:688299-688321 GAGAGGCCCCGGGGTCCACCTGG + Intronic
969219915 4:5752783-5752805 GGGGTGTCCTGGGAACCACCAGG - Intronic
969222454 4:5770101-5770123 GTGCTGCCCTCAGCTCCACCAGG - Intronic
969343387 4:6556450-6556472 GAAGTCCCCTGAGCTCCATCCGG - Intronic
972995992 4:44879956-44879978 GAGCTGTGGTGGGCTCCACCCGG - Intergenic
975001146 4:69224299-69224321 GAGGGGCCATGGTCTCAACCAGG + Intergenic
977814091 4:101393392-101393414 CAGGTGCCCAGGGCTTCACATGG + Intergenic
979260392 4:118638411-118638433 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
981138851 4:141243718-141243740 GGAGTCCGCTGGGCTCCACCTGG + Intergenic
981520179 4:145652755-145652777 GAGGTGCCTGGGGCTATACCTGG - Intronic
981959758 4:150522688-150522710 GAGGTGGCCTGAACTGCACCTGG - Intronic
983668321 4:170207583-170207605 GAGCTGCGGTGGGCTCCACCCGG - Intergenic
985576986 5:678117-678139 GGGGTTTCCTGGGCTGCACCCGG - Intronic
985591906 5:770170-770192 GGGGTTTCCTGGGCTGCACCCGG - Intergenic
985823079 5:2173797-2173819 TAGGAGCCCTGGGCCCCAGCAGG - Intergenic
985907604 5:2853148-2853170 GCGGTGCCCTGGGAGCCACATGG - Intergenic
986285146 5:6353789-6353811 GGGGAACCCTGGGCGCCACCCGG - Intergenic
986653888 5:9991231-9991253 GAGCTGCGGTGGGCTCCACCCGG - Intergenic
987074602 5:14369228-14369250 AAGGAGCCATGGGCTCCACCTGG - Intronic
988637708 5:33004943-33004965 GAAGTGTGCTGGGCTTCACCTGG + Intergenic
989418259 5:41205731-41205753 GAGCTGTGGTGGGCTCCACCAGG - Intronic
989567496 5:42915789-42915811 GAGGCGGCCTGGGCTGCAGCGGG - Intergenic
990042517 5:51390491-51390513 GTGGAGGCCTGGGCTTCACCTGG - Intronic
991052948 5:62292035-62292057 GAGCTGCGGTGGGCTCCACCCGG - Intergenic
994350290 5:98737692-98737714 GAGCTGCCATGGGCTCCACCCGG - Intergenic
995566441 5:113436088-113436110 GAAGGGCCCAGGGTTCCACCTGG - Intronic
1002644766 5:180647754-180647776 GGGGTGTCCTGGGCTGGACCTGG - Intronic
1002730944 5:181331479-181331501 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1002753589 6:142625-142647 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1003533093 6:6954092-6954114 GAGTGGCCCTGGGCCCCACCAGG + Intergenic
1003556261 6:7142344-7142366 GCGCTGCCCTCGGCACCACCGGG + Intronic
1004072985 6:12318995-12319017 GAGGTGCCCTTGTCTACATCTGG - Intergenic
1005963828 6:30712411-30712433 GAGCTCACCTGGGATCCACCTGG - Exonic
1006472768 6:34237639-34237661 GAGGTGCGCCGGGCTCCTCCGGG - Intronic
1008339189 6:50344225-50344247 GAGCTGCGATGGGCTCCACAGGG - Intergenic
1009820710 6:68797485-68797507 TAAGTGCCCTGCCCTCCACCTGG - Intronic
1010136169 6:72555659-72555681 TAGCTGCCCTGGGCTCCGCAGGG - Intergenic
1010593365 6:77736143-77736165 GAGCTGTTGTGGGCTCCACCGGG + Intronic
1011533542 6:88351312-88351334 GAGCTGTGGTGGGCTCCACCCGG - Intergenic
1011545995 6:88481925-88481947 GAGCACCCCTTGGCTCCACCAGG - Intergenic
1015560951 6:134515274-134515296 CAGCTTCCCTGGCCTCCACCTGG - Intergenic
1015784641 6:136909484-136909506 GAGGTCCCCTGGGGACCACATGG + Intronic
1015882252 6:137881172-137881194 GATGGGCCCTGGGGCCCACCGGG + Exonic
1018126812 6:160690511-160690533 GAGCTGTCCTGGGCTGAACCTGG - Intergenic
1018149740 6:160926581-160926603 GAGCTGCCCTGGGCTGAATCTGG + Intergenic
1018977416 6:168575917-168575939 GGGGTGCACTGGCCTTCACCTGG - Intronic
1018996942 6:168717212-168717234 GGGTGGCCCTGGGCTCCAACAGG + Intergenic
1019173405 6:170147426-170147448 GCGGGGCCCCTGGCTCCACCTGG - Intergenic
1019291357 7:252153-252175 GATGTGCCCTTGGCTCCGGCAGG - Intronic
1019291382 7:252244-252266 GATGTGCCCTCGGCTCCGGCAGG - Intronic
1019291428 7:252426-252448 AATGTGCTCTGGGCTCCAGCAGG - Intronic
1019291452 7:252517-252539 AATGTGCTCTGGGCTCCAGCAGG - Intronic
1019416890 7:931974-931996 GAGCTGCACTGGGCCCCCCCTGG - Intronic
1019918937 7:4150661-4150683 GAGCTGCCAGGGGCTTCACCTGG - Intronic
1020619590 7:10501451-10501473 GAGCTGTGCTGGGCTCCACCCGG - Intergenic
1022904283 7:34840752-34840774 CAGCTGCCCTGGGCTGCCCCAGG - Intronic
1023402108 7:39798011-39798033 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1023455997 7:40339375-40339397 GAGCTGCGGTGGGCTCCACCTGG + Intronic
1023547901 7:41338593-41338615 GAGGTGCCCATGGCACCAGCTGG + Intergenic
1024046272 7:45587652-45587674 GAGGGGCCCAGGGCTCCTCCAGG + Intronic
1024076087 7:45818641-45818663 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1024082256 7:45865187-45865209 GAGGTGCCCTGGCCCTCTCCTGG - Intergenic
1024220677 7:47284193-47284215 AAGGTGCCTTGGGCTCCACCTGG - Intronic
1025051349 7:55737144-55737166 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1025060117 7:55798399-55798421 GAGGAGCCCTGGGCCCCTCAGGG + Intronic
1025176699 7:56805692-56805714 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1025237010 7:57241358-57241380 GCGGTGCCCTGGTCTGCACAGGG + Intergenic
1025295322 7:57771851-57771873 GTGGTCGCCTTGGCTCCACCTGG + Intergenic
1026488158 7:70838567-70838589 GAGCTGCAGTGGGCTCCGCCCGG - Intergenic
1028264386 7:88705231-88705253 AAGGTGCCCCAGGCTCCAGCTGG + Intergenic
1029359888 7:100081109-100081131 GCGATGCACTGGGCTCCAGCAGG + Intronic
1032052622 7:128658404-128658426 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1032478219 7:132226717-132226739 GGGGGGCTCAGGGCTCCACCGGG + Intronic
1033680060 7:143584791-143584813 GAGCTGTGATGGGCTCCACCCGG - Intergenic
1033691775 7:143744651-143744673 GAGCTGTGATGGGCTCCACCCGG + Intergenic
1034866601 7:154647597-154647619 CATGTGCCCTGGGCTCCCTCTGG + Intronic
1034929522 7:155150586-155150608 GAGGGTGCCTGGGCTCCTCCTGG - Intergenic
1035338135 7:158143267-158143289 GAAGGGTCCCGGGCTCCACCAGG + Intronic
1035406845 7:158604262-158604284 GAGGTCCCCTGGGCTCCTCTGGG - Intergenic
1035421554 7:158733120-158733142 GATGTGCACTGGCCACCACCAGG - Exonic
1035649509 8:1254249-1254271 GATGTGCCCGGGGTTCCCCCAGG - Intergenic
1035663552 8:1364279-1364301 GGGGTGCCCTGTGCTCCAGGTGG + Intergenic
1035819954 8:2580374-2580396 GAGGTGGCCTGGACTCCAGAGGG - Intergenic
1036560570 8:9897934-9897956 AAGGTGCCCTGAGCTGCACGGGG - Intergenic
1038260275 8:25986921-25986943 GGGGAGCCCAGGCCTCCACCTGG + Intronic
1038454874 8:27666727-27666749 GATGTACCATGGGCTCCTCCTGG + Intronic
1040414934 8:47187636-47187658 TAGGGGCCCTGGGCTGCACTGGG + Intergenic
1040612385 8:48998107-48998129 GAGCTGCAGTGGGCTCCACCCGG - Intergenic
1042865935 8:73356763-73356785 GAGGAGGCCGGGGCTCCGCCTGG - Intergenic
1043497944 8:80823432-80823454 GAGCTGCAGTGGGCTCCACCAGG - Intronic
1049253600 8:141602483-141602505 GAGTTGCCCTTCGCTCCTCCTGG - Intergenic
1049797779 8:144504463-144504485 GAGGGGCCCTGGGCCATACCTGG - Exonic
1049805145 8:144535423-144535445 GAGGGGCCCTTGGTTCCACATGG - Intronic
1050175589 9:2866610-2866632 TGGGTACCCAGGGCTCCACCTGG - Intergenic
1050247673 9:3708166-3708188 GAAGTTTCCTGGGCTCCAACTGG - Intergenic
1051379672 9:16442963-16442985 GAGGTGCCCTCTGCCACACCTGG - Intronic
1055484039 9:76739599-76739621 GAGCTGCCCTAGGCTTCACTTGG - Intronic
1056940263 9:90949560-90949582 GAGGTGCCATGGGCTTGCCCAGG + Intergenic
1057305994 9:93912322-93912344 CAGGCTCCCTGGGCTCCTCCGGG + Intergenic
1059297851 9:113288243-113288265 GACGTTTCCTGGGCACCACCTGG + Exonic
1059452815 9:114381336-114381358 GGGCTGGCCTGGGCTTCACCTGG + Exonic
1059507405 9:114812463-114812485 AAGACTCCCTGGGCTCCACCCGG - Intergenic
1060110624 9:120904143-120904165 GAGGTGCCTCTGGCTGCACCTGG + Exonic
1060524234 9:124311511-124311533 CAGGTGTCCTGGGGTCCTCCTGG + Intronic
1061294229 9:129668089-129668111 GAGAGTCCCTGGGCTCCGCCCGG + Intronic
1061318402 9:129812462-129812484 TAGGTGCCCTGGGCTGCCCTAGG + Intergenic
1061719294 9:132541962-132541984 GATCTGCCCTGGGGTTCACCAGG - Intronic
1062047696 9:134432046-134432068 GAGGTGCCTGGGCCTCCTCCTGG + Intronic
1062235697 9:135506589-135506611 GGGCTGCCCTGAGCTCCTCCAGG - Intergenic
1062324395 9:136005233-136005255 GAGGGGGCCTGGGACCCACCTGG + Intergenic
1062559761 9:137136304-137136326 GAGGGTCCCTGGGCTCCCCCAGG + Intergenic
1062755350 9:138283986-138284008 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1203579263 Un_KI270745v1:28158-28180 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1186185031 X:7012422-7012444 GAGATCCCCTTGGCTCCACAAGG + Intergenic
1188465269 X:30472522-30472544 CAGGTGACCTTGGCTCAACCAGG - Intergenic
1191273478 X:58510859-58510881 GAGCTGTGGTGGGCTCCACCTGG - Intergenic
1192362541 X:70448788-70448810 GAGGTGACCTGGGGTGCACTTGG + Intronic
1193352023 X:80474899-80474921 GAGCTGTGGTGGGCTCCACCTGG + Intergenic
1195833712 X:109089005-109089027 GAGCTGCAGTGGGCTCCACCTGG + Intergenic
1198267453 X:135022490-135022512 GAGCTGCGCTGGGCTTCGCCGGG + Exonic
1199223511 X:145344203-145344225 GAGGTGCTCTGAGCTGTACCTGG + Intergenic
1199677022 X:150197560-150197582 GAAGTTCCCTGGGTGCCACCTGG - Intergenic
1201303553 Y:12531380-12531402 GAGCTGCTCTGTGCCCCACCAGG - Intergenic
1201364018 Y:13184598-13184620 GAGCTGTGGTGGGCTCCACCCGG + Intergenic
1201752213 Y:17445369-17445391 GAGCTGCAGTGGGCTCCACCTGG + Intergenic
1202381871 Y:24280780-24280802 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1202488913 Y:25389345-25389367 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic